Are You Ready for the “No One Could Have Known” Routine?
Thomas Harrington
Ready for another rendition of the “no one could have known” routine made famous by all the self-proclaimed liberals who shamelessly went along with the Neo-Cons planned and lie-supported destruction of the Middle East nearly two decades ago?
As in “no one could have known” that by shutting down life as we know it to focus obsessively on a virus mostly affecting what is still a relatively small number of people at the end of their lives (yes, oh squeamish ones we must summon the courage to talk about Quality Adjusted Life Years when making public policy) we probably would:
1. Cause economic devastation and hence excess deaths, suicides, divorces depressions in much larger numbers than those killed by the virus.
2. Provide an already monopolistic and predatory online retailing establishment with competitive advantages in terms of capital reserves and market share that will make it virtually impossible at any time in the near or medium future for the country’s and the world’s small and even medium-sized businesses to ever catch up to them. And that this will plunge huge sectors of the world-wide economy into serf-like ruin, with all that this portends in terms of additional death and human suffering.
3. Cause greatly increased misery and countless additional deaths in the so-called Global South where many people, rightly or wrongly, depend on the consumption patterns of us relatively fortunate sit-at-homers to make it through the week.
4. Destroy much of what was attractive about urban life as we know it and lead to a real estate collapse of extraordinary proportions, turning even our few remaining showplace cities into crime-ridden reserves of ever more desperate people.
5. Force state and local governments, already struggling before the crisis, and unable to print at money at will like the Feds, to cut their already insufficient budgets at a time when their broke and stressed constituents need those services more than ever.
6. Push “smart” monitoring of our lives, already intolerable for anyone still clinging to memories of freedom in the pre-September 11th world, to the point where most people will no longer understand what people used to know as privacy, intimacy or the simple dignity of being left alone.
7. Train of a generation of children to be fearful and distrustful of others from day one, and to view bending to diktats “to keep them safe”, (no matter how empirically dubious the actual threat to them might be), rather than the courageous pursuit of joy and human fullness, as the key goal in life.
We will also no doubt be told that no one could have imagined or known at the time:
That governments often make policy on the basis of information they know to be largely unsubstantiated or flat-out false. Because they know (Karl Rove spilled the beans in his famous interview with Ron Susskind) that by the time the few conscientious researchers out there get around looking past the hype to debunk their initial storylines, the structures favorable to them put into place on the basis of the false narrative will have been normalized, and thus be in no danger of being dismantled.
That our educational institutions, already failing miserably in the essential democratic task of educating the young to engage in productive conflict with those whose ideas are different than their own, will only further promote dehumanization of “the other” through ever-greater reliance on the disembodied practices of remote learning. And that this, in turn, will only encourage the further growth of the “drive-by shooting” approach to “coping” with new and challenging ideas seen so often in our public “discussions” in recent years.
That further fomenting the alienated and alienating educational practices mentioned above will make than it easier than it already is for our oligarchs to enhance their already obscene levels control over our daily lives and long-term destinies through divide and rule tactics.
That according to the Institute for Democracy and Election Assistance (IDEA) fully twos thirds of elections scheduled to be held since February have been postponed due to COVID. And that this does much to accustom citizens and populations to the idea that one of their few remaining democratic rights can essentially be taken away on the basis of bureaucratic whims, creating a dangerous “new normal” that obviously favors the interests of established centers of power.
That Sweden and other countries developed much more proportionate, culture-saving and dignity-saving ways to live safely and much more fully with the virus.
That Anthony Fauci has a well-documented tendency to see every health problem as being amenable to expensive pharmaceutical solutions (some might even call it corruption), even when other less intrusive, less expensive, and equally effective therapies are available.
That the recent history of using vaccines to fight respiratory infections has been ineffective when not grotesquely counterproductive.
That during the first half of the 20th century the infectious disease of polio was a constant danger, culminating in 1952 with a devastating toll of 3,145 deaths and 21,269 cases of paralysis in a US population of 162,000,000, almost all of the victims being children and young adults. The danger then to the under-24 population (some 34 million) of being infected (.169%) paralyzed (.044%) or killed (.0092%) far outstripped in percentages and, obviously, severity anything COVID is doing to the same age group. And yet there was no talk of blanket school closures, cancelled high school, college and pro sports or, needless to say, lockdowns or masking for the entire society.
That the world lost some 1.1 million people in the 1957-58 Asian flu epidemic (more than the present COVID number of 760,000), with some 116,000 in the US (.064% of the population) and the world similarly did not stop.
That the Hong Kong flu of 1968-69 killed between 1 and 4 million worldwide and some 100,000 in the US (.048% of population killed) and that life similarly was not stopped. Indeed, Woodstock took place in the middle of it.
That the decisions to get on with life in all of these cases were probably not the result, as some today might be tempted suggest, of a lack of scientific knowledge or lesser concern for the value of life, but rather a keener understanding in the more historically-minded heads of that time that risk is always part of life and that aggressive attempts to eliminate this most ubiquitous human reality can often lead to severe unwanted consequences.
That there were many prestigious scientists, including Nobel prize winners, who told us as early as March that this virus, while new, would in greater or lesser measure behave much like all viruses before it and fade away. And, therefore, the best way to deal with it was to let it run its course while protecting the most vulnerable people in society and letting everyone else live their lives.
That significant information platforms banned or sidelined the views of these high-prestige scientists, while aggressively circulating the words of jokers like Neil Ferguson at Imperial College, whose stupid and alarmist predictions of COVID mortality (the latest in a career full of stupid and alarmist, but not coincidentally, pharmaceutical-industry-friendly predictions), gave politicians the pretext for setting in motion perhaps the most aggressive experiment in social engineering in the history of the world.
That just as the levels of mortality from the virus were diminishing rapidly in the late spring and early summer of 2020, thus raising hope for a much-needed return to normality, there was seamless bait and switch in the major media from a discourse centering on the logical and laudable goal of “flattening the curve” to one centered on the absurdly utopian (and not coincidentally vaccine-oriented) goal of eliminating new “cases”.
That having the news media focus narrowly and obsessively on the growth of “cases” when 99%+ of them are completely non-life-threatening was journalistic malpractice of the highest order, comparable to, if not exceeding in its sinister effect that which was generated by the media’s wholly unsubstantiated talk of mushroom clouds and WMD two decades ago, talk that led (so sorry brown people) to the deaths of millions and the destruction of entire civilizations in the Middle East.
That government and corporate power holders, having successfully habituated people to engage in major solidarity-destroying social changes through the repetition of the largely meaningless term “case“, will surely come to rely on it and other breathlessly repeated, albeit largely empty, signifiers to paralyze society at will, especially at those times when the people appear to be waking up and coming together to demand a change In the existing balance of social power.
That as numerous existing and emerging studies seem to demonstrate, hydroxychloroquine is, when combined with other similarly affordable drugs, a safe and rather effective early-stage treatment for COVID 19.
That the negative studies on hydroxychloroquine effectiveness published at two of the most prestigious medical journals in the world The Lancet and the New England Journal of Medicine, and which were adduced time and again at a key moment in the early debate of possible COVID treatments to debunk the drug’s effectiveness, were found to be based on forged data sets. (see earlier entry on how power centers play the game of perception lag with false information to achieve long-term structural changes)
That suggesting world-class professional athletes in their 20s and 30s, or even their less talented and less fit high school and college counterparts, were running a risk of mortal consequences in even minimal numbers by playing in the midst of the COVID spread was, in light of known age-related numbers on the disease’s lethality, at best ridiculous and, at worst, a very cynical fear-mongering ploy.
Repeat after me, “no one could have possibly known these things” and then check your screen to see, as citizens of Oceania, whether you are supposed to be worried this week about the threat from Eurasia or Eastasia.
And, of course, I’d be remiss if I didn’t remind you to mask up real tight, especially in light of the CDC numbers — you’ll have to forgive here for breaking with the rich tradition of pure panic-driven narrative and moving to the realm of empirical figures — which tell us that up until this point in our “everything must change” crisis:
- 0.011% of the US population under 65 have died of COVID
- 0.005% of the US population under 55 have died of COVID
- 0.0009% of the US population under 35 have died of COVID
- 0.0002% of the US population under 25 have died of COVID
- 0.00008% of the US population under 15 have died of COVID
And as for the most “high risk” people?
- 0.23% of the US population over 65 have died of COVID
Though they’ve tried to sell it otherwise, this thing has very little, if anything, to do with great-grandma’s Spanish flu of 1918.
Indeed, it not even completely clear if it is cumulatively worse in terms of loss of life than the influenzas outbreaks of 1957-58 or 1968-69 that most everyone slept through. But, I guess that doesn’t matter when there’s a narrative to keep.
Might it be time to ask if there might be something else afoot with all this?
Thomas S. Harrington is a professor of Hispanic Studies at Trinity College in Hartford, Connecticut and the author of the recently published book, Livin’ la Vida Barroca: American Culture in a Time of Imperial Orthodoxies.
SUPPORT OFFGUARDIAN
If you enjoy OffG's content, please help us make our monthly fund-raising goal and keep the site alive.
For other ways to donate, including direct-transfer bank details click HERE.
Good article. I have been banging on about education for a while. I have one son who studied at Imperial College. The other doing a PHD at Oxford.
Both great at their subjects, but clueless when it comes to the world around them. Yes, ordinarily much of that will naturally come with life experience and maturity. But I sense their achievements will go up in smoke, their incomprehension of life around them the defining factor.
Apparently, psychologists did a study a few years ago that showed that people who live in areas where viruses and epidemics are common are more likely to conform to authority, to be “conservative,” in other words, not rebellious. Under threat, people get scared and cling to powerful authority figures whom they hope will rescue them.
Question is, why were psychologists studying this? Who hired them to do that research? Had the powers that be (the PTB) been planning on using a virus to get people back under control for the past few years?
I’m thinking about how both democrats and republicans here in the US had plans to stop the hippie movement of the 60s. That social rebellion resulted in major changes in our society. The PTB didn’t like that.
Could it be that the Bernie Sanders campaign and the Occupy movement reminded the PTB too much of that 60s rebellion? Are they pushing back now? Around the world, people have been decrying economic inequality and increasing poverty resulting from the PTB’s corporate greed and selfishness.
What a perfect way to quash rebellion by telling all those hippie good-doers that if they don’t stay away from each other they’re harming their fellow human. Want to make the world a better place, to change the world, to end human suffering? Stay away from your fellow human being!
It’s really ingenious. I’m actually impressed by how good the PTB is at controlling us. Sadly, we have a population of people who know very little about history or current events. Because if they did have some knowledge of that, they’d realize that conspiracies are a part of life–always have been. Hitler conspired to kill millions of his own people. He wanted to obliterate an entire race of people. I suppose that sounded crazy to people at the time, which is why they ignored the warnings of what the nazis planned on doing. Of course, at the end of WWII, many Germans–including Hitler’s private secretary–claimed they “didn’t know” what Hitler was up to. Guess this is just history repeating itself. What’s sad, though, is that those of us who are aware of what is really going on can still be dragged into the world’s self-destruction the way that Moishe (in Elie Wiesel’s “Night”) was probably arrested and exterminated along with the others.
tks for post
And there isn’t even a virus! Read “Dismantling the Virus Theory”
http://wissenschafftplus.de/uploads/article/Dismantling-the-Virus-Theory.pdf
Moreover, the “Spanish Flu” deaths were causes by the medical profession:
The fashion in the day of the Spanish flu was to administer high-dose aspirin which caused the massive number of deaths.
“Aspirin contributed to the incidence and severity of viral pathology, bacterial infection, and death, because physicians of the day were unaware that the regimens (8.0–31.2 g per day) produce levels associated with hyperventilation and pulmonary edema in 33% and 3% of recipients, respectively. Recently, pulmonary edema was found at autopsy in 46% of 26 salicylate-intoxicated adults.
Experimentally, salicylates increase lung fluid and protein levels and impair mucociliary clearance.”
Oxford Journals Medicine & Health Clinical Infectious Diseases Volume 49, Issue 9
Pp. 1405-1410
Can you please also post the announced part 2 of Dr. Lanka’s Dismantling-the-Virus-Theory in english?
Please friends make this viral chlorine dioxide is the cure for this virus, we have to stop people from thinking the vaccine is the cure. https://andreaskalcker.com/en/
Something else is indeed afoot! Thank you, Thomas for a most exacting exposé of the current global débâcle. I can only presume that our ‘rulers’ have other goals in mind: This short video (18 mins) explains it all.https://www.youtube.com/watch?v=rStL7niR7gs
I have written a book about all this and much more which has taken me seven years ever since the Cyprus bank robbery of March 2013. I now write a weekly Letter to my American readers keeping them abreast of events here in UK:
https://www.theburningplatform.com/author/austrian-peter/
“Who Could’ve Known?”
Why, anyone who read Atlas Shrugged, of course. All of us who did, and who have least bit of understanding of history, human nature and Statism knew. We’ve seen this coming for well more than a decade.
(Duh!)
The wheels fell off this wagon months ago. Why are the majority still cowering? Predictably, Bill Gates blames our ‘freedom’ (when not subjected to ‘lockdowns’) for the ‘spread’ (mostly asymptomatic) of the Dreaded Flu Lurgy, not obsessive testing. Of course, the Rockefeller crew seemed to have this all set-out yonks ago:
https://covidtruefacts.blogspot.com/2020/08/bill-gates-tells-porkies-and-scott.html
If you want to mention small percentages, let’s not forget that the Spanish flu killed only 0.48% of the American population at the time, or “only” 500,000 people. And that was after all three of the waves of the flu had passed, and we have no idea of how many waves we will have with the coronavirus, we have only had the first one, with 180,000 deaths and counting. So yeah, I think comparisons with the Spanish flu are pretty correct. Are you going to say that people a century ago were already sissies that made a big deal of something that was nowhere near the Black Death? Should we resign ourselves that nothing less than killing most of the population is business as usual and it makes no sense to do a thing to try to protect people?
Then, there’s the idea that “lockdown” caused the economic devastation. If the governments had your attitude, then it would have been the people locking down. Look at Sweden, famous Sweden. People were told to do whatever they wanted, and what did they do? They social distanced. They stopped going into shops. They sent their economy down regardless.
The positive RTqPCR test used to incorrectly label a person as a “case” is currently misused as a diagnostic. There is as high as 30% false-positive rate. It is a fact that “inconclusive” RTqPCR results are currently being recorded as positives. Inconclusive results indicate contamination. Decrease in exports, not productivity, resulted in contraction of Sweden’s economy.
I was ready for that question back on April 22, when the first lockdown caused the “case” statistics to rocket, and the German Minister of Health, Jens Spahn, suggested in pensive tones: “In a few months we will probably have to forgive each other a lot.”
I’m sure he hopes we have all forgotten that rather cryptic statement, but it is quite plain that HE knew…
This article speaks the truth therefore must be labelled “tin foil hat”
So there’s an idea that was (to the best of my knowledge) most ably championed and possibly originated by Arthur Silber, which says that the obvious and predictable outcomes of any policy ARE the reasons why that policy is enacted.
e.g. the War on Drugs is NOT a “failure” because it increases the number of law enforcement officers, judges, prisons, lawyers, etc. It is NOT a “failure” because it corrupts all of the above. It is NOT a failure because it increases the potency and lethality of illicit substances. It is not a failure because it increases the number and profits of criminal drug traffickers.
If these policies were failing for the people with the power to make or change policy then these policies would have been changed decades ago. The reason why the rich and powerful have not changed these policies is because they work beautifully FOR THE RICH AND POWERFUL.
like everything else – follow the money. This is about the billion$$ that will be made from an UNTESTED most likely harmful vaccine that Fauci has been pushing for when there are already very effective natural alternatives – zinc/ NAC / Quercetin / Vitamin C etc;
The BILLions made is only one of the consequences i reckon.. The wider agenda is more about power and domination that a small % of deeply insecure psychopaths infected by a truly dangerous virus will have, over the world population… A percentage smaller than the percentage of people killed by CV19.
The pawns must get together to defeat these false kings.
The first known case of Spanish flu was in the US Fort Riley, Kansas military base. All military personnel were at the time vaccinated (for typhus and other illnesses) and cells from hen’s eggs were used in the vaccine no doubt causing the H1N1 pandemic as viruses that cross to species not used to them can be extremely dangerous. The hens themselves were kept in awful, crowded conditions, due in part to the war situation, so were also susceptible to viruses. CV-19(84) has been dangerous for many health care workers (all vaccinated against the flu) and old and sick people, also generally vaccinated. Just saying.
As a side note, high polio incidence was probably caused by the extensive use of DDT used on schools, playgrounds, etc, and was demonstrably kept going by vaccination with live strains in many cases. We are told it has been eradicated in western countries, but it has more likely be renamed as Guillain-Barré syndrome in order for the vaccine narrative to hold water.
Michele – I’m a 30 year environmental industry professional and I’ve never seen any evidence (or even suggestion) that DDT use caused polio. Would appreciate any reference you can provide.
I have a close friend who grew up behind the Iron Curtain in Romania. When he was a child of about 2 or so, his mother left a small vial of about 3 ounces of DDT on a counter. When she was outside he guzzled the entire vial. He was rushed to the village clinic and had his stomach pumped but by then, most of it had been absorbed.
He’s now 61 and in perfect health. To my knowledge as an industry professional, DDT is not toxic to humans and the Ruckelshaus EPA decision to ban it was purely political, and expressly against the science advisors within his own agency.
No prior knowledge….
https://youtu.be/rvlZgBo_Ums?t=2
What about the previous scams by the WHO like swine flu etc. this is their m.o.
People really need to understand the vaccine situation. I know it is difficult if you are not trained to read scientific papers, as most of the information is hidden from plain view and there is an enormous media aggression against people who question any vaccine. However, please find the technical names for the proposed vaccines, go to PubMed and start digging. You need to get informed as if your life depends on it, which, let me tell you, does.
I am not anti-vaccine person in general, and I trust the tried-and-proven vaccine technologies. However, the technologies that the governments are suggesting to force upon people are novel and experimental. This is a FACT.
I have done some research into the technical details of mRNA and DNA vaccines in terms of adverse effects. There has never been a FDA-approved mRNA vaccine. There have been clinical trials in severely sick people, such as patients with advanced cancer. It was difficult to see the side-effects in severely ill people with cancer, not to mention if they developed new cancers from the vaccine, because 1) they already had complex side effects and 2) did not live very long to provide long-term data. Therefore, there is no history of data from healthy individuals. The story is similar with DNA vaccines. The DNA vaccines have been shown to cause severe disease when the person gets exposed to a virus at a later time (sometimes months or years later). This is called antibody-dependent enhancement (ADE) and is associated with mRNA vaccines, as well. The DNA vaccines are based on technology to genetically engineer cells and laboratory animals such as worms, mice and rats for lab experiments.
There is still very limited knowledge about the complex and diverse immune responses to this SARS-Cov2. The companies are racing to develop a way to induce the immune response to the virus without knowing what is the appropriate immune response to this virus! The human immune system is very complex and, in this case, unique to each person. If tweaked the wrong way through a vaccine, it can be triggered to overreact to a common cold and result in a life-or-death situation. If you got vaccinated with either mRNA or DNA vaccine, you would be living with a time-bomb and praying, or worse: sitting at home worried about catching a common cold lest your immune response overreacts!
Usually, vaccines are developed after thorough research to understand the nature of immune response to the specific virus, as all viruses induce diverse responses. Right now, they are developing vaccines more or less blindly, with emphasis on speed.
However, the bottom line is: the pandemic is leaving, and is finished in many places. Every person should now focus on protecting their lives from a far greater threat than SARS-Cov2 ever was. Why they would do this to people is besides the point. Your precious health is now threatened by the vaccine. I recommend resistance on a large scale.
What if the problem isn’t DYING from CV, but SURVIVING a case of it? What if the lasting effect on heart, lungs, and kidneys cripple many, many people for life? Stay tuned, the studies that indicate this are piling up….
There is a ‘brand’ you called CV – we are branded cattle if we buy into the brand.
Toxic exposures, undermined and malnourished immune function – along with dysfunctional synergies that can turn our immune response against us, all operate as multiple sins protected and pharmed out to the sucklings as a viral cover story.
Your comment has the tenor of taking delight in purveying fear as if it vindicates you.
The use of studies as PR is often as blatant a fraud as MSM.
Where is the study that proves Sars-Cov-2 causes anything?
What exactly IS the clinical DISEASE that is supposed to be threatening Human Civilisation, while being used as a pretext for just that by the shutdown of our rights and freedoms while undermining our life support?
What if the lasting effect of TREATMENTS or Vaccines sets up a continuing ‘disease’ as an ever mutating novel plot?
Have you researched HIV and AIDS yet – or do you take lockdown as a holiday?
Tuning into fear is the ‘virus’ – period.
What studies would they be John? I understand that the “virus” has only been around for 10 months or so. Lasting effects? Just saying.
Fungus, from toenail and beyond, kills more people a year…and over generations hundreds of millions. 1/7 people in the WORLD are dealing with a fungal issue. Where’s the Marshall plan for that one???
Good question. But now I’m off to give my toenails a severe clipping, and scrub down the bloody cuticles with bleach.
Terrific article. I would only fault it on two possible grounds. The first being that the number of deaths ascribed to CV-1984 has been vastly and deliberately magnified. While the author does indicate that even these bogus, magnified numbers show just how inappropriate the Cabal’s global response has been, he might have spared a paragraph outlining the fraud in the numbers. Second is the fraud surrounding the tests, particularly the rt-PCR test which forms the “basis” for the concept of both asymptomatic and symptomatic “cases.” This rt-PCR test looks for a snippet of RNA but the connection between this snippet and CV-1984 has never been properly proven. As a matter of fact, the “novel” virus has never been properly isolated. There exists 4 papers indicating in their abstracts that it has, but when the authors where confronted point blank by molecular biologist as to whether the virus has really been purified, they backed down with a “no.”
However, there does appear to be a new and very nasty disease in a small minority of hospitalizations, which was best described by whistleblower ICU MD Cameron Kyle-Sidell who was promptly banned from the ICU for this indiscretion. It is marked by severe hypoxia in the blood and severe hemorrhagic damage to the lungs in the rare cases where autopsies were performed. As Kyle-Sidell had treated many pneumonia patients previously, he was struck by the fact that these patients were remarkably cognitively coherent as opposed to advanced pneumonia patients. After having just completed reading The Invisible Rainbow by Arthur Firstenberg, a truly remarkable book which I would recommend wholeheartedly, I am more than suspicious that this “novel” illness is being caused by the frantic rollout of 5G, possibly worsened by the ubiquitous concentration in bodies of glyphosate. Even the most tentative connection between 5G and CV-1984 is enough to get a video banned on gootube in a NY minute.
Dr Zach Bush has repeatedly made the same connection between this phenomenon and glyphosate, he says it’s basically cyanide poisoning, air pollution causing the virus to clump, and the clumps acting as a conduit into the lungs of the glyphosate and other residues of agriculture spraying, which is why the phenomenon is centered in areas with high air pollution and high levels of agricultural spray residues (and 5G too), e.g. Wuhan, northern Italy, New York City.
Firstenberg gathers a lot of interesting history but purposes all of it to push man made electricity as yet another version of CO2. I’m open to emf being a toxic exposure – but if you were to seriously look at say The 1918 ‘flu’ and limit it to electrical causes with no mention of massive vaccinations using live virus strains along with massive overdosing with Bayer’s (then Monsanto’s) aspirin – I would seriously question your desire for truth and think you were pushing your own agenda.
Fear and guilt agenda operate a self-reinforcing action-reaction.
There are other potential candidates for death by hypoxia.
And if 5G (or bioweapons) were being applied in this event, they either proved duds or were only used in very selected trials. Bioweapons may include any intent to set up for the undermining of health in the target.
Covid as a shaped charge may be forced to wreak damage along predetermined vectors. So anything that feeds and fuels the fear is part of the ‘political expediency’ as long as the reaction to the fear doesn’t undermine the rollout of a global system of real-time surveillance and control.
Fear and guilt operate a mind-capture.
I agree with your observations that the virus as asserted and ‘tested’ is baseless.
Once so many invest by reaction, its is given demonic power in the ‘currency of exchange’ – much as cholesterol was – or saturated fats – or sunshine. It’s the economy, covid!
The one thing I would endeavour to correct in the article is the statement: “ Though they’ve tried to sell it otherwise, this thing has very little, if anything, to do with great-grandma’s Spanish flu of 1918.”
Dissolved solids in tap water such as calcium carbonate that prevent pathogens from being carried in the water system, result in impairments to sodium ion channels when free calcium ions occupy these channels, leading to a receptor that advantages viral pathogens, especially in the macrophages.
The various dissolvable tasteless odourless salts that were, for the first time, introduced to the water system prior to WW1, and widely in use the world over by that time, was considered a triumph over typhoid and cholera. But the introduction of these salts may have created the conditions necessary for a 5% loss in the world population in 1918.
The one place in the world that believes in fresh water as a pillar of health and has for centuries has access to glacial run-off is Iceland. They also have the lowest mortality rate.
People with calcium ion channel impairment diseases such as multiple sclerosis are under very strict quarantine requirements, because the very nature of their disease makes them susceptible.
The solution would be to filter tap water in use, but can take up to 12 months before the metabolism normalizes.
Some source for these claims would be appreciated. Does this apply to any virus – or just the Spanish Flu and covid19?
We should be very suspicious of any claim that ends up reinforcing the central propaganda message – that covid19 is unique and dangerous.
You will not find adequate source material unless you manage to uncover a medical website that discusses the issue in depth.
Viral receptors that specifically match those on the cell walls especially SARS-type and very specific flu viruses where there’s no herd immunity, especially if these viruses use the macrophages as transport are the biggest concern. It’s not only one specific kind of virus that is capable of infection.
Just making coffee introduces calcium ion precipitate into the bloodstream, which then proceeds to interfere in sodium ion channels, producing impaired cells. A number of factors contribute to a pandemic, but if I were to select from a list of factors, I would chose dissolved solids in tap water.
No one will find adequate source material because it does not exist.
Receptors are like electrical code locks.
Where do you find there to be ‘no immunity’ to any cold, corona or flu infections? Have you heard of white blood cells?
While you are free to select whatver factors you want for your own reasons – who are you to make this list of claims that are not even part of any biological or medical research I have met – apart from seeking to bolster the ‘virus’ while introducing disinfo?
On what basis – for what purpose and to what possibly useful outcome?
Well the above reply is certainly attempting to paraphrase. The irony to not wearing a mask is you might have natural immunity, but will get diarrhea over and over and not conscientiously wash hands. So I look at ppl refusing to wear a mask as constantly suffering from diarrhea.
But the entire pandemic as a whole may have been avoided if filtering tap water was as much a requirement as say, having a stove and a fridge or hot and cold running water.
This is what I’m trying to point out.
I don’t share or support any of what you are suggesting at all as making any kind of sense.
The ‘Pandemic’ is media generated. If the media could have been stoped from spewing fear like diarrhoea – no one would have been aware of a ‘pandemic’.
It operates in the minds of many as a ‘breakdown’ or corruption and distortion of communication – overlaid on a not very different from average seasonal spike in human deaths.
Loss of ability to think in the true or full sense of consciously engaged enquiry and exploration is the ‘group-think’ of a managed population.
Some of that can be supported by neurotoxic exposures – some of which may be in tap water.
But calcium carbonate?
I appreciate your confusion as an opportunity to restate some key points.
So chalk or limescale impairs our ph balance to leave us open to ‘pathogens’?
I can make a case for the other halogens than iodine such as chlorine, and later bromine and fluorine displacing iodine (which is a significant part of cell functioning) – as they all can use the same receptor. But even so not as anything to do with presumed pathogenic viruses – excepting that under toxic conditions, viral and bacterial response can result in a detoxification failing to be effected – and further breakdown of function experienced – and toxic water is one vector of exposure among many.
The removal of bacterial growths associated with bad water may be more about the endotoxins some such bacteria excrete than the bacteria in and of themselves.
Like the OG Ed I suggest you share your sources.
The body’s ability to support life, as cells, as blood and as a homeostasis of symbiotic cooperation is much more open to being undermined by deficiancy and toxicity – especially when toxicity is injected to by pass the normal immune defences.
I also just commented on this page with other candidates for 1918 ‘flu’.
I agree that NOW we have toxic water in some degree in may places – but basic sanitation and better nutrition were in my view the obvious cause of the steep decline or cessation of what were considered the scourge of contagious disease that later, vaccination revisionists sought to take credit for.
There are other reasons to put a value on pure glacial melt. And there is a LOT more to water than H2O.
MS may be resulting from methanol toxicity – which converts to formaldehyde.
Yeast cells can die from their own (alcoholic) excreta. As human beings we are dying in our own toxic effluents. I do not count CO2 in that category.
PERHAPS the covid controllers intend to de-industrialise under cover story so as to retain ‘control’ over a contracted and degraded population. But the point of holding conditions of order against chaos was for stability in which Life can grow and flower – not for ‘genetic control’ to abort or experimentally effect as if gods over Life.
No, this interpretation is completely wrong. Free calcium carbonate ions through precipitate from tap water will impair sodium ion channels.
The immediate reaction to any such notion is one of immediate denial, when in fact there’s little available to the public knowledge about making a standards of living improvement.
You can SAY it is wrong and you can SAY there is little (No) information publicly available.
Can you SAY what you believe a sodium ion channel is and does?
Not accepting what you SAY just because you SAY it is not a reaction of immediate denial. You flatter yourself!
It’s the perfect alibi for the banksters’ plunder of the public purse.
This is 2008 on steroids and the banksters knew they had to camouflage what they were doing.
And of course, the banksters’ gambling debts are so great that repaying them will require more than all our taxes.
Why do people think settling the bad debts of gamblers should take precedence over everything else?
I’m intrigued……
What else is comming down the road?
Is this a reset to cover for the failure of the International Financial Ponzi Scheme going pop?
Is it an amlagamation of behind the scenes UN/WHO at play, imposing on the unwashed from a position of ‘The Greater Good’?
Is it an imposition by the Puppet Masters, The Courtier Class aided by their Familias because too many people are now starting to question the Kabuke Theatre thats is the outcome of playing the film ‘Freedom/Democacy’ 24/7 and being worn worn thin?
Is it a trial run, protection against a meteor strike, or a war game gone live like 9/11, 7/7…….?
Is it a confleuence of many things, solving many problems of the Puppet Masters as their play has gone off script?
Waiting for the next episode from the Puppet Masters, ‘The Greater Good, Part Deux’
I can’t say if anything is afoot but I welcome the pandemic even though I am in a risk group and my spouse is doubly vulnerable.
I welcome the pandemic because it is likely to delay WWIII which the US so lovingly prepared since they decided they could not let go of their wonderful powertool NATO about 25 years ago.
They no longer speak of peace but of security, the euphemism for war preparations.
Covid costs money and there is a limit as to how much you can squeeze from people – so less money for war.
Covid impacts soldiers – so fewer soldiers for war.
Covid impacts recruitment – so fewer soldiers for war.
Covid impacts espionage because spies will need to go into quarantine – slows their obnoxious activities right down.
Covid makes people suffer, but less than war, so I welcome Covid as an anti-war accident.
We have printing presses, so money is not a problem.
Warmongers always have a way of financing War.
We are already in world war 3, this time they have dispensed with political fictions and will go straight to slaughtering the populace directly,at least those of no use, better wake up wilmer.
If you are in any sense believing what you write you are so dissociated from what this global lockdown and coup is effecting as to be fresh out of Netflix.
How is squeezing people of their own life support not war?
How is monopolising war as a top down extinction event – an anti-war ;accident’?
I probably give you too much in replying to such folly – but for whatever reasons very many are welcoming covid under belief that their pet hates will be vindicated.
Of course you speaking of War, the old way.
The new way is Political, Financial, Assassinations, Terroirst Attacks and Propaganda and using bodies like the UN/Security Council/IMF/WHO….
War(war) is their last resort.
Six months ago ‘you’ were complaining how corporate influence bought Washington; how lobby groups write the laws; and politicians are bought and paid. No one mentions that now.
People keep saying, the media, look how compliant they are. But who owns the country? The politicians or the corporations? So why are the corporations silent?
You can’t shut the store and send the workers home without the complicity of the beneficial owners. Sure you can screw the mom and pop corner store, but the corporations that “built this city”? Where did they go?
There’s ya clue. They have to be complicit but how? Via the chamber of commerce? The business associations? The Freemasons?
You don’t have to know anything about business to see that here’s a very important question – and where’s the answer?
Great post by Caltrop
Didn’t watch Event201 meeting where the Gates paid admins planned to run this through CEO’s of all companies for top down directives to all employees?
Certainly did. Noticed it in January but we are in a minority. Many people are distracted by the theatrics of the media, even here.
That’s the media’s purpose – CNN screeching like a shrill teenager with his crotch caught on a barbed wire fence. Countering it is still the core purpose of this site.
I’m thinking we are in complete agreement and I did not understand that you were restating a problem instead of arguing for it.
They have closed the store. You aren’t going to be needing it.
Thanks very much for this. However, i don’t see much in the way of apologetics yet, the “the self-proclaimed liberals who shamelessly” are going along with this lockdown are if anything more steadfast than ever, attacking anyone who dissents as if they are right wing dupes, particularly in the US, where the mantra is that if you’re not for the lockdown, you’re for Trump.
Gotta love folk mad about bad govt enough to protest (esp at risk of a dread disease) who trust their govt more than 100% when it comes to ruining everyone’s life over healthcare democide.
Liberalism is mental syphilis, unfortunately they will be the first on the chopping block, useful idiots according to Lenin.
Bravo
My music theory is pretty sketchy, but “antecedent-consequent phrase” comes to mind.
The antecedent “no one could have known” is a setup for the consequent “mistakes were made”.
My delayedly published comment from this afternoon
DunGroanin
Aug 22, 2020 12:24 PM
Another complete pile of non sequiturs by a non entity aimed only at a emotional reaction with a word salad incantation.
No there was no coordinated physical distancing in 1957 when a million died for example, people had very little idea of mass travel and viruses. It would have been a lot LESS than that million, if reacted to better with testing, tracking and isolating!
They didn’t rush to invent pointless medication for big Pharma profits either as they are doing now. There was an extreme of postwar superpower/ old imperial recalculation too that would have ignored most chaos in far off domains with brown/black people. Outta sight outta mind.
When such poetical writing is deployed whee a serious scientific response is vital – one has to ask WHY?
Who benefits from such emotional button pushing? What is being camouflaged? We can see the how daily in these arenas.
Well it must only be to divert FROM the scientific conclusions which are daily emerging as the data is revealing.
The most insidious part of the authors message is the callous nature of treating the seriously ill and dying with contempt of being ‘old’ and ‘worthless’ anyway!
Blaming people’s longevity or long term illnesses for their misfortune!
Both LIES.
It seems to ignore that the Agrofood/medical/Pharma industries have made their fortunes from these very SAME people – by stuffing them full off their poisonous products and so made them the victims.
The linking fact is not AGE it is the health (and hence food and drugs) regimes of these victims.
The more it is understood of how this virus is causing the Covid diseases which other viruses don’t the plainer that FACT becomes.
It points to the perpetrators of the poisoning.
The old global robber barons and their big Agro/Pharma soma. Hence the whole political and media slaves are deployed in this effort to obfuscate the truth – with Fear from one side and plain nutty denialism lies from the other – whilst still using the crises to further their eternal aims.
It will NOT WORK this time. The world is not living n the great imperialistSuper powered controlled era of half a century ago now.
It is easy to denigrate and ignore their main stream propaganda in the traditional media as it is to do their Alt- stream media, with their’ punter narrative’ pincers, on sites such as this.
The aim being to keep us in their own ‘overtonian window’ of attention as just of the edges the real shit is dished out.
Bring on the clown blue monkey troll bot choir to prove my point.
Well if I may be permitted to become as suspicious as you, I’d say this complaint about delayed posting is just an excuse to post twice. This comment also appears further down.
Govern/rule – ment/mind
How Real Mind Control Works
“………………I think some of the political applications of this are obvious.
The false left/right paradigm is a perfect Petri dish for obtaining or manufacturing the consent of the masses to be hypnotized. They WANT to believe that their team, which they have willingly joined, is the correct team and that the leadership of that team has their best interests at heart. They want to believe that the actions of their party, through legislation or direct means, are always rational and morally sound. And, even when the leaders of their party do things which are completely contrary to the beliefs and morals of the people who make up the party, those people still want to believe that there must be some logical reason behind these decisions that they do not yet grasp.
Beyond this, the threat of the “other party” or team is an ever constant stimulus in the form of fear. We watch the scripted battles of these two fabricated teams play out in elaborate forms of Kabuki theater, yet nothing ever really changes except that the global elites grow more powerful. Still, many people actually believe these battles to be real, and invest immense amounts of energy and focus into them as if the fate of the world is being decided within the antics of a political soap opera.
When people are afraid or hyperfocused on an outside threat, they once again become more suggestible. This is why mainstream political discussions focus less on understanding of the threat (the “How” and the “Why”) and more on perpetuating the threat. With understanding of the enemy (or false enemy), the threat can be assessed and fear is reduced, even if the threat is real. Without understanding, fear only increases. Political powers seek to constantly remind us that threats exist without allowing us the benefit of context. They do not want us to have an in-depth knowledge of the mechanics behind the threats……………………”
http://www.renegadetribune.com/how-real-mind-control-works/
Urgent Information About Your Future
Everyone is shouting to get my attention.
😉
Here is a definition of abundance:
Knowing what you need to know in the moment that you need to know.
Correlating with not knowing what you don’t need to know when you don’t need to know it.
One of the first reasons I had to not take the bait (of any such scam) is to not give trust to anything that does not extend communication but weaponises it – in fear and guilt leverage.
Thanks – but no thanks.
I don’t say that there is nothing of value or potentially useful information in the linked video – but its resort is the exact same mindset of mind control.
You are free to cry wolf! or to save the world as you see fit – but if you care – why don’t you extend something that indicates more than a clickbait gone viral because everyone says everyone else should know this?
Our future has been removed for violating YouTube’s Terms of Service.
Washington D.C. (District of Columbia)
“Columbia” is a name for “Goddess of Creation, War, and Destruction” more known as the goddess of death and pain. She is derived from the imagery of Semiramis, wife of Nimrod, and Queen of Babylon.
The statue on top of the Capitol building called the Statue of Freedom is actually Persephone, meaning “She who Destroys the Light”. She is the queen of the underworld. She is crowned with pentacles (pentagrams–stars with five points). When someone stands on something, it is usually an indication of ownership. Therefore, she owns the facility she stands upon. Although the dome on top of the Capitol building was not finished until 1868, the final installation of this statue on top of the dome took place on December 2, 1863. The original Capitol building, without the dome, was completed in 1826.
Columbia and Persephone are seen as other statues around Washington D.C. area.
Some of the Gnostic Priesthood include: Illuminati, Skull & Bones Society, Hospitaliers, Knights of Malta, Knights of Columbus, Knights of the Round Table, Oddfellows, Society of Jesus, Jesuit Priesthood, Club of Rome, Knights Templar, Freemasons, Scottish Rite Temple, York Rite Temple, Shriners, Inner Temple Bar, International Temple Bar Association, Barrister’s Inn, Zionists, Jesuits, Jesuit Brotherhood, Milner group (a.k.a. Milner’s Kindergarten, Round Table Group, Rhodes crowd, Rhodes Scholars, The Times crowd, All Souls goup, Cliveden set, The Society of the Elect, The Association of Helpers, Junta of Three, the Secret Society of Cecil Rhodes, Chatham House crowd, Commonwealth of Nations, Royal Institute of International Affairs), Tri-laterial Commission, Bilderberg group, Council on Foreign Relations (CFR), Magistrates, Bar Attorneys.
“Since 1873, the Global Elite Has Held Secret Meetings in the Ancient Redwood Forest of Northern California. Members of the so-called “Bohemian Club” Include Former Presidents Eisenhower, Nixon and Reagan. The Bush Family Maintains a Strong Involvement. Each Year at Bohemian Grove, Members of This All-Male “Club” put on Red, Black and Silver Robes and Conduct an Occult Ritual Wherein They Worship a Giant Stone Owl, Sacrificing a Human Being in Effigy to What They Call the ‘Great Owl of Bohemia.'”–Alex Jones; InfoWars.com
There is a small owl just to the left of the “1” which appears on the upper right hand corner of the One Dollar Bill
http://www.usavsus.info/
snoozy
I’m not given to conspiracy theories myself but everything you say is indeed true. The owl/Northern California weirdness — actually “just a harmless bit of fun” — was written up in the book “Them! Adventures with Extremists” by Jon Ronson. Its now a fairly old book but I strongly recommend it to anyone who wants to get some feel for how shadowy organizations work and in particular the lives of the ordinary people who make up their membership. (Mr. Ronson figured that if the World was really being ruled from “Smoke Fille Rooms” then as an investigative journalist he should be able to find them. What he actually found was not only highly entertaining but also very surprising.)
Coronavirus and the Fog of War
https://www.minds.com/darzoum/blog/coronavirus-and-the-fog-of-war-1096601089459326976
“The fog of war” is a phrase used to characterize the confusion and fear that can ensue in battle. Confusion and fear are states of mind in which clear, critical thinking is short-circuited. Besides being a haphazard byproduct of battle, this “fog” can be deliberately deployed as a tactic to disable and subjugate a people. Regardless of your favorite theory on the origin and severity of the coronavirus—deliberate bio-weapon or bats in an open air food market, genuine existential threat to humanity or just another flu—it should be obvious by now how this virus is being used to disable the general population through confusion and fear.
Yes.
A sane explanation of the mess we’re in:
https://syrianobservatoryforhumanwrongs.wordpress.com/2020/08/21/lies-lost-lives-and-lockdowns-explained/
This has all been planned; and I know that many people still have a hard job getting their head around this.
If you can’t see the obvious facts that are blatantly out there, there’s not much more that someone like me can say.
Enjoy your slavery. You’re obviously gagging for it.
And the planning has been made as plain as day!
“It’s hard to get a man to understand something when his salary depend on his not understanding it.” -Upton Sinclair [speaking to today’s “alt”-media?]
You’re not going to convince me that this is all some sort of malevolent plan for world domination by anonymous (or semi-anonymous) “elites”.
No disrespect to those who do believe that. You’re entitled to your opinion. And I am entitled to mine. I do think that what happened is that plans were drawn up for what to do if a deadly plague affecting millions of people came along and that these plans have now been implemented.
That, I think is why many people believe it was planned. Because there is an element of planning in all this madness. Rockefeller’s document that has received some publicity was examining what might happen and what governments might to about it. And maybe that document has been influential as well.
But the bottom line for me is that this is not a plan for global domination. It is hapless governments treating a relatively harmless virus like it is the bubonic plague when it just isn’t.
During past (more serious) pandemics governments may have had:
“a keener understanding … that risk is always part of life and that aggressive attempts to eliminate this most ubiquitous human reality can often lead to severe unwanted consequences.”
I agree with this.
The key difference is that governments have clearly in recent years drawn up plans of how to deal with these things, when before they never thought to instigate such grandiose, crude and delusional plans.
This seems to be part of a shift in technologically advanced societies towards “safetyism”.
Looking at formula One motor racing. Sorry, but it’s now a sport for pussies. It’s completely safe. Multi millionaire “drivers” like woke Lewis Hamilton strut around the globe with their masks preaching about BLM.
Fifty years ago Formula One was a genuinely dangerous sport and even the very best risked their lives. It was a sport that required dedication and courage. Jim Clark, Jochen Rindt, Ronnie Petersen, Gilles Villeneuve and Ayrton Senna were just five top drivers who died at the wheel.
In 1977 at the SA Grand Prix a particularly horrific accident took out Welsh driver Tom Pryce and a trackside marshal. Was the race stopped? No. The race winner Nikki Lauda was told about the fatalities on the podium. Celebrations were muted, but there was no sentimentality.
Death was a risk that drivers were willing to take for their sport.
What do we have now that we didn’t have 50 years ago? Seatbelts in cars (I’m okay with that), speed limits on cars, 20 mph zones all over cities complete with speed humps.
Schools are now often protected from view in case paedophiles might be around. Many jobs involving dealing with children and vulnerable people have police checks. Builders have to wear hard hats, ‘elf and safety is everywhere.
Many of these things even people here will agree with, but it is still a shift to a more cautious and less carefree way of being.
Pretty, perhaps you need to grow-up.
Not to mention, grow a pair.
You’re right, Mr. Pretty: the Very Few just get *incredibly lucky* over and over and over
and over and over..
“We just can’t believe our good fortune!”
yeesh.
I can also say that I am gratefully not as ‘lucky’ as those hollowed out parodies of life that have been taken over by lovelessly driven intent.
Which is to say that what we most value in life is where we place our treasure and from which receive our sense of who we are and what life is.
The nature of deceit is not of ‘getting away with it’ but of loss of any true appreciation in exchange for fantasies of power acted out upon the body of the living under false pretences – that cannot really be escaped so much as masked by denials that are stored – like treasures in heaven – but as an abundance of debt.
In some defence of John Pretty, the nature of the deceived can operate so as to demand to be supported in an ‘unconsciousness’. Without invoking blame, I simply say that relational investments or contracts become self reinforcing patterns or autonomous and unmindful ‘habits’.
Breaking a circle of addiction or false dependency is always easy in theory.
Selling theory can then pre-empt a true witness for life – such as to drown in solutions that are sold by unhealed healers.
The fact is that not only do they persist in the face of mounting evidence that they are wrong, that the virus is relatively harmless., they are becoming more strident with their attacks on dissenters and on scientists who are presenting such evidence, and are pushing ever more severe lockdown measures. Don’t tell me they are merely “hapless” when they push the pedal to the metal no matter what. I personally don’t think the virus was actually engineered to further this plan, but there was a plan waiting for an opportune moment and when it came the movers and shakers swung into action.
Ironic Pretty. You pretend to have read and watched the plandemic’s masters own websites and videos that were made before the plandemic was executed. If you had read and watched them, you would know that after the plandemic was launched, they followed their scripts exactly and are still following them.
Are you telling us that what they are doing to New Zealanders and Aussies is just ineptitude? These same Gates paid monsters have stated and are stating all along what they are doing. It does not stop with a vaccine or a brief lockdown. It is endless and entails rfid read/writable invisible nano tattoos (but not chips). It is endless mandatory vaccines and other uninformed consent medical procedures. It is cashless society. It is social credit score more locked down than the CCP. It is 24/7 surveillance. It is complete destruction and replacement of food systems that produce anything other than the worst gmo’d, pesticided, factory farmed trash veiled as food for everyone not in their big club.
Ah. You could be right though. Perhaps it’s just a theory about this conspiracy. Perhaps websites for Gates, GAVI, CDC, Yale, UN, WHO, Johns Hopkins, Monsanto/Bayer, GSK, Moderna, and all the rest are just conspiracy theory sites. So if I am wrong and this all just goes away, they ok. But if you are wrong and that helps bring this “Children of Men” scenario into fruition, well, then I guess you were just doing the exact thing the author of this article is talking about, huh?
My impression are that the Very Few are creating with real deliberation a world
that only utter supplicants would willing live in, and where I live there seem to be
plenty of them, I’m so sorry to say. Happy Maskies, I call them under my breath..
Mencken was right
He was usually right. That doesn’t change this from victim blaming though. It’s what the gaslighting stockholmers will tell the rest of their soon to be victims and their judas goats.
> That doesn’t change this from victim blaming though.
I hear you, but my comment comes from a feeling of great frustration.
“Look around you, people!! Wake up!!” I want to shout at them, as they
drive around with masks on and windows rolled up..
#we’reHosed
Yep. I am considering patterns. Gates Fdtn (et al) goals and strategies are stated and remain the same. Their tactics are masked until after the fact and then papered over as the authors here outline. To peg this performance in the future, give a thought to technologies available that the vast majority have no clue exist.
Here’s a hint. 3+2G is almost installed everywhere. It uses the same 60GHz frequency as the allegedly less than lethal “Active Denial” system. Once installed and turned up, it will be pervasive. Remember the bird die off in Brussels near the NATO HQ the day they turned on 3+2G there?
The symptoms for electromag radiation toxicity happen to match this alleged virus that to date has been harmless to all but the almost dead. Zinc deficiency (common in malnourished humans) also matches the symptom list. Also some metal toxicities match symptoms as well. You know, the kinds of metals common to air pollution in cities like Milan, Wuhan and parts of NY? Cyanide?
Between turning up 3+2G in the fall along with food shortages and pollution, what do you expect to see in the next 2 to 6 months?
What do you expect the normies will think? You know the normies right? Those same folk protesting because they do not trust their government enough to trust police nor school systems? The Orange Man bad crowd? The same folk wearing masks insisting that since Orange Man disagrees with Fauci that Fauci and Gates must be truthful and good and worthy of trust with the lives of their grandkids?
Yeh, so what do you expect the normies – the maskies to think when they actually do see people falling down around them? Do you think they will listen to crazy conspiracy theorists who are smart enough not to fall for the fallacy of the single cause? Or will the maskies panic more and demand more and more totalitarianism and democide in all its versions to purge their world of this wicked invisible monster?
http://tapnewswire.com/2020/08/27-year-old-worker-hangs-dead-from-microwaved-water-tower-after-heart-attack-two-others-were-too-weak-to-climb-down-and-needed-to-be-rescued/
Does this explain, the Gates’ smug snickers about how people will take them more seriously after the second wave?
Defeat or disempowerment by death of a thousand cuts includes regulatory capture.
Corporate cartels operate outside the surface appearances of an Economy or Political process as a parasitic underbelly. The only difference with covid is in the unmasking of a global directive operating at local levels systemically.
Yes you are entitled you your view – regardless whether you get ‘liked or not’.
I cannot really articulate mine (though that doesn’t stop me 😉
My sense is that you have to believe in ‘haplessness’ as part of your faith in reason.
Love of life has been exchanged for fear of pain of loss – as if a power of protection.
The unfolding of ideas that are invested in as currency can be seen as happenstance.
But when it comes to what is accepted and adopted we have to look at the power of the established order of the day – and also see how the ideas are operating the consolidation and reinforcement of ideas that can be weaponised and marketised.
Possession and control defines in order to predict and control as the protection of profit, and active defence or destruction or absorption and subversion of rivals or competition.
Is the open business (in large part) by so called globalists a ‘conspiracy’ or simply the generating of an alternate body politic amidst a sideshow of diversion in which the ‘golems’ sleep?
“Binra™” and “Big B™” really should get a room.. maybe make it a threesome with “Rachel”.
C.
I have a vibrational domain already. Uniqueness is a signature of truth.
I don’t ‘really should’ people but if I did I might say you should be talked about as if you are not here. But then how much of this is an entertainment in soap drama? Or narrative investments? I recognise you are here and don’t care to deny your right.
One of the attributes of consciousness is of a richness of reflecting perspectives – as distinct from programmed linear meanings running predicted linear outcomes. Biodiversity of wholeness in all its parts happens all at once.
As such I welcome your contribution as timely – because synchronicity doesn’t just apply to ‘special alignments’ but to misalignments or apparently random comments.
Nothing you said has any coherent value, nor does it contribute to any sort of debate or discussion, you literally just pulled sentences out of your asshole to jerk off to your own apparent writing fetish, the classic “I love to hear myself talk” syndrome
Thank you for sharing your perspective Arnib. I also love to listen.
If you opened any kind of debate or discussion, I missed it.
If what you say has coherent value for you, you are welcome to it.
Appearances can be deceptive.
But you are right that I enjoy the moment where formless felt meanings find expression in form.
It takes one to know one.
If you had anything to say you could have said it – but – look at you.
John Pretty, at what point of malevolent governance and democide, do you stop convincing yourself that governments are inept and hapless? NZ much?
Black vs white vs pink vs gay vs straight vs bi (greedy) vs tory vs labour vs male vs female vs brexiteer vs remoaner vs mask warers vs non mask warers……..
They sure have enough groupings/religions/ideologies in the population to keep us arguing amongst ourselves rather than directing our wrath against the Puppet Masters, their Courtiers running the Kabuke Theatre with their Familias in MSM using the Cattle Class (Zombies) taking us happily down the road to an Apocalypse.
George Carlin….he kept telling it how it is, and still they sleep
Today’s gaslighting from CaitlinJohnstone™:
https://caitlinjohnstone.com/2020/08/22/on-covid-19-and-authoritarian-abuses/
She’s just *super* fair-minded; unlike all those of us questioning the persistent, pervasive, and overwhelming COVID-19!!! fear-mongering.
Just ask her..
#hallofMirrors2020
C.
I hope even those who no longer regularly read Ms. Johnstone (like me) will have a look
at her piece that I linked, because it’s quite well (read *cleverly and slipperily*) written, with its “how dare you!” tone; a la Naked Capitalism/Capitulation, Ian Welsh, MoA,
Automatic Earth, and most all others..
Whoever writes “her” stuff knows what’s going on, as do the others mentioned.
Doesn’t the ‘virus’ look very similar to a depiction of a water mine?
I think you fell short. Fauci is in hot competition with others for the tittle of #1 enemy of mankind. His crimes may be punished in the not so distant future.
Just think, even Trump can’t fire Fauci, reportedly.
yeh. why is that?
“Indeed, it not even completely clear if it is cumulatively worse in terms of loss of life than the influenzas outbreaks of 1957-58 or 1968-69 that most everyone slept through.”
Hang on a minute. I never slept through the 1958 flu outbreak though it confined me to bed. I was thirteen, but then it affected young people as well as almost everyone else. Doctor’s used to visit then (you can’t even visit the practice these days without some rigmarole) and my temperature was 105F (second highest on Dr. Lee’s list).
I remember getting out of bed to go to the toilet and collapsing in a heap. My leg muscles would not support me. It was pretty serious. I guess if you get a bad dose of the virus (whatever the virus) it is devastating. But yes, we did not do lockdowns, social-distancing or masks. The world’s gone mad over a virus that has already long since peaked. That the public of the world have bought into the nonsense is all the more worrying.
There was the Apollo 8 launched on December 21, 1968. Radiation Control for Health and Safety Act of 1968 was an amendment to the Public Health Service Act mandating performance standards for electronic products suspectible of electromagnetic radiation or radiation emissions. 1968: Radiation alert following B-52 crash. An American Air Force B-52 bomber armed with four hydrogen bombs crashed into the sea near the Arctic air base of Thule in Greenland. That was probably around when people had all tv sets for the first time. I think the problem with the smart phones is ever worse that it stops people thinking straight and remembering things like they are in a state of confusion.
MSM is the enemy of the people.
Politicians are just scared of bad press.
The left like overzealous traffic controllers have found a new weapon, health and safety.
MSM have shot themselves in the foot and have cried wolf too long that most people have caught on and tuned out. This will only hurt MSM further and severely put a dent in their already fragile credibility.
I was born in 1975 and had a flu bad enough at age 18 or so i collapsed in the hallway. It scared us all.
Far beyond that, on a visit to my 80 yr old grandmother in the 1990s, my neices and sister caught a bug, unknowingly passed it on to her (or more accurately and probably foolhardily, took the risk so she could meet her great-grandchildren for the first and only time) and she caught pneumonia and died within a week of our visit.
Very painful but no one but my sometimes-bitchy aunt has ever dreamed of blaming them for gericide or considered the situ anything beyond the facts of life on earth and fickle Fortune. My god, she was over 80, her husband had died the year previous, she even told me that visit she’d had a good life and was ready to go!!
Strange and apparently rare mindset required of us these days……yes, flu’s can be deadly and serious but, like, still……THE FLU.
Yes. When you collapse from a virus you’ve got it bad. I almost laugh when people say “I’ve just had a touch of flu.” Or “I was off with one-day flu.” And of course they are right too. A virus does not affect everybody in the same way.
Informative anecdotes. They all go to show that this virus, though different, can still finish off those with weak immune systems. But back in the day it was the co-morbidities that they died from. Unlike today.
The “scientific” paper “Investigation of a COVID-19 outbreak in Germany resulting from a single travel-associated primary case: a case series,” from “The Lancet Infectious Diseases,” is a complete fabrication.
The article claims to document a case where Covid-19 was spread from China to Europe.
The carrier of Covid-19 was Patient 0, a Chinese business woman who traveled from Shanghai to Munich on Jan 19, 2020, to facilitate workshops, and attend meetings with her German colleagues. She showed no signs of illness during her stay in Germany, although she mentions suffering from jet-lag. She returned to China on Jan 22 where she became ill, and on Jan 26 tested positive for Covid-19. It is claimed that, although asymptomatic at the time, she passed the disease to a number of German associates, who then passed it to others. Those who tested positive for Covid-19 (by qRT-PCR) had their virus sequenced. The sequences were submitted to GenBank. Those infected were called the Munich cluster.
One of those infected, Patient 1, is claimed to have caught the disease from Patient 0. Patient 1 then passed the disease to Patient 3. Since Patient 3’s only contact was with Patient 1, this certainly appears plausible, however, this turns out to have been impossible.
Consider the mutations (changes from the standard Wuhan sequence) of Patients 1 & 3.
Patient 1, MT270101.1, SARS-CoV-2/human/DEU/BavPat1-ChVir929/2020, complete genome. ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGT1- (deletion at beginning) C241T (substitution at position 241) C3037T (substitution at 3037) A23403G (substitution at 23403) CCATGTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA29837- (deletion at end)
Patient 3, MT270103.1, SARS-CoV-2/human/DEU/BavPat3-ChVir1020/2020, complete genome. ATTAAAGGTTTATACCTTCCCAGGTAACA1- (deletion at beginning) C241T (substitution at 241) C3037T (substitution at 3037) A23403G (substitution at 23403) TGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA29867- (deletion at end)
Given these, it is impossible that Patient 3 caught Covid-19 from Patient 1.
Relative to the standard Wuhan sequence, the virus from Patient 1 has lost (from its beginning) the segment
ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGT
However, the virus from Patient 3 has lost (from its beginning) only the shorter segment
ATTAAAGGTTTATACCTTCCCAGGTAACA
Also, the virus from Patient 1 has lost (from its end) the segment
CCATGTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
However, the virus from Patient 3 has lost (from its end) only the shorter segment
TGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Therefore Patient 1 cannot have transmitted the virus to Patient 3, unless the virus from Patient 1 somehow found the missing segment AACCAACCAACTTTCGATCTCTTGT, and attached it to its beginning, and also found the missing segment CCATGTGATTTTAATAGCTTCTTAGGAGAA, and attached it to its end, with these attachments occurring sometime during the transmission. But this is clearly impossible.
For the same reason, the claimed transmissions from Patient 4 to Patient 5, and from Patient 5 to Patient 7, are impossible.
From: http://www.preearth.net/phpBB3/viewtopic.php?f=15&t=1184
WHAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAT?
Another lie to worry about. So what should we do next?
Ahhh, you forget though. This is a very sneaky virus. Bill Gates said so.
Still no scientific proof that asymptomatics spread covid. It’s just a hypothesis.
You’d think that after 9 months they would have proof but they don’t so that tells you that asymptomatics don’t spread it.
There is no virus, only a bioweapon created in a lab.
Whether that bioweapon was spread anywhere is yet to be determined.
The tests do not test for a virus but fractions of enzymes not unique to SARS-COV-2 which coincidentally, has never been isolated or purified.
Therefore the tests are scientifically meaningless. Therefore a positive test result means nothing other than you tested positive for an enzyme.
People are not carrying a virus, nor are they contagious.
The symptoms of Covid-19 from the CDC website exactly mirror that of radiation sickness.
The mortality statistics in every country correlate precisely with the lockdowns, proving the policy change of reporting deaths as covid-19 related, are wholly responsible for the manipulated and massaged
mortality figures.
This is a pre-planned and co-ordinated global effort by governments, security apparatus, technocrats, bankers, pharma and industry to put measures in place to control populations through government integrated tech platforms using digital currency, global IDs, Immunity Passports, RFID chips, AI, medical martial law, 5g, drones, robots, facial recognition, contact tracing, forced isolation, contact tracing, ankle monitors, quarantining and unlawful imprisonment, the destruction of property, and the seizing of assets, land and businesses.
The lockdowns heighten financial and psychological trauma, divide the populous and hasten the global economic catastrophe around the corner.
Governments have instituted these measures and prohibitive laws to control citizens and remove their financial independence, while simultaneously providing governments, economists, bankers, think tanks and academic institutions with a built in excuse (” … because, virus … ”) for the looming bank failures, bankruptcies, CLOs, markets and indices collapse and the systemic collapse of crony capitalism.
The technocratic march to tyranny will continue as long as the scientific, medical, political, judicial and monetary fraud is not called out.
The “leaders” will not be persuaded by facts and they are not interested in the welfare of the people.
Governments exist to control you, not to help you or represent you.
Until people are willing to acknowledge that fact, nothing can change.
Take your governments back by declaring the current leaders incompetent and compromised by their monetary and political alliances with corporations that have no allegiance or responsibility to anything other than fiat money, and which are majority owned by fiat bankers.
‘The “leaders” will not be persuaded by facts’. This is a claim, not a fact, and without any evidence to support it. I see a lot of other dramatic claims in this post (eg ‘government’s exist to control you’), but again, nothing to support them, so I will not be persuaded.
Until you see democide up closer and more personal.
Agree with most of your points except there was no bio weapon released.
By releasing a bio weapon they’d have no control over it and who it could infect.
I didn’t use the word “released“.
Are you sure? Besides, there are many things that give these symptoms. Zinc deficiency. Electromagnetic radiation toxicity. I wonder what small doses of cyanide or arsenic poisoning look like. Reminds me of the https://en.wikipedia.org/wiki/Fallacy_of_the_single_cause
Wow… can you cite some helpful facts to back up these assertions? “There is no virus”?
The Covid Vaccine’s Dirty Secret
The Highwire with Del Bigtree
August 21st, 2020
While Big Pharma races to get a #Covid19 vaccine on the market, prominent vaccine experts can’t help but raise red flags surrounding a well-known, but hushed, side effect that has already proven to be a serious problem in SARS vaccines. Sit down for an important lesson in immune enhancement with Dr. “Neu.”
(Excerpt from ep.177: Covid19: Connecting the Dots)
https://www.bitchute.com/video/k1uz1Sl4T3Dt/
—
https://www.bioenergymedicalcenter.com/
About Bio Energy Medical Center
A holistic center focused on total physical and mental health, Bio Energy Medical Center in Ann Arbor, Michigan, provides compassionate family-oriented wellness care. Directed by Dr. James Neuenschwander, the Bio Energy approach to patient care incorporates prevention, energy balance and natural ways of healing.
Excellent HighWire interview, thanks for the link. If I were objective I would describe the analysis as fascinating, but as a subjective observer (we could all fall foul of this) I would describe it as horrifying. It is what Dolores Cahill and others have also been saying all along and goes even further in identifying risks. Technical explanations but well explained and comprehensible to a non-scientist like me.
Best visual demonstration of the uselessness of face masks:
I still smile at the guy who said you can wear underpants and trousers and a fart still gets out! I paraphrase.
Thank you, John. With your agreement I shall use that anecdote to reenforce my stance on mask wearing, especially when dining out. Brilliant.
Yes and no. I share the view that masks are not only useless, but harmful and despicable on many levels. So I’m sympathetic to the demonstration.
But when I watched this video, my thought was that would-be “debunkers” could plausibly claim that Dr. Noel is blowing the smoke out rather than exhaling normally.
That’s a pic of the mask WORKING. Coughs and sneezes don’t go directly in someone else’s face… and what does represents a lower inoculum, which the body has a better chance of overcoming than tons of (politely) sneeze material.
BBC headline “Coronavirus will be with us forever – scientist”. Sir Mark Walport who is on the SAGE Committee has made this claim and states that people will need to be vaccinated at regular intervals.
My immediate reaction was to ‘google’ Sir Mark Walport and the Gates Foundation. First entry that appeared:
https://dmm.biologists.org/content/3/5-6/265
To save too much bother reading the whole entry, I recommend paragraph 3. This rolls up Walport, Wellcome Foundation, Imperial College and the Gates Foundation all into one neat package.
I haven’t as yet read beyond that so there may well be additional direct connections but this seems enough to confirm my suspicions.
Big pharma and their captive experts in advisory positions have had great success in demonizing and thus preventing access to life-saving HCQ in various western nations like the UK, France, Belgium and many others. These countries have the highest fatality rates in the world. Countries using HCQ routinely, correctly, and from the early months of the pandemic have 80% lower mortality rates in average. This information cannot be found in the corporate MSM, which is beholden to global elites, only in independent media. The same MSM also worked very hard to smear and ridicule Trump, both for saying HCQ had great promise, and for using it himself as a preventative treatment. I ask posters to consider very carefully how many other stories the MSM are feeding society on behalf of their owners and their woke values, especially anything about the only major world leader standing up to corporate and globalist interests.
These people need to be jailed along with many others in the BBC hierarchy. Scum of the earth.
BBC is propaganda.
It was the BBC claiming WTC7 collapsed before it even happened.
They never had an answer or explanation.
Come on now. Jimmy Saville was that close to cleaning up the BBC when he passed.
Jimmy Saville cleaned up the BBC BY dying!
You’ll find in the link below an article titled, “Faith in Quick Test Leads to Epidemic That Wasn’t.” It reports on the (fictional) whooping cough epidemic of 2006 in the US.
The article dates back to 2007 and was published in the official paper of record here in the US- The NY Times.
It perfectly illustrates the fallacy of, “No one could have known”, as relates specifically to the (mis)use of the PCR tests. After reading through this piece does anyone want to argue that they did not know that these PCR tests would fulfill the role of providing (false-manufactured) the evidence/rationale for an epidemic/pandemic?
They KNEW these tests to be fraudulent but have kept using them through the years- and this by only accident and incompetence?
A few highlighted points from the article:
For months, nearly everyone involved thought the medical center had had a huge whooping cough outbreak, with extensive ramifications. Nearly 1,000 health care workers at the hospital in Lebanon, N.H., were given a preliminary test and furloughed from work until their results were in; 142 people, including Dr. Herndon, were told they appeared to have the disease; and thousands were given antibiotics and a vaccine for protection. Hospital beds were taken out of commission, including some in intensive care.
Then, about eight months later, health care workers were dumbfounded to receive an e-mail message from the hospital administration informing them that the whole thing was a false alarm.
Not a single case of whooping cough was confirmed with the definitive test, growing the bacterium, Bordetella pertussis, in the laboratory. Instead, it appears the health care workers probably were afflicted with ordinary respiratory diseases like the common cold.
Now, as they look back on the episode, epidemiologists and infectious disease specialists say the problem was that they placed too much faith in a quick and highly sensitive molecular test that led them astray.
………
“It’s a problem; we know it’s a problem,” Dr. Perl said. “My guess is that what happened at Dartmouth is going to become more common.”
Many of the new molecular tests are quick but technically demanding, and each laboratory may do them in its own way. These tests, called “home brews,” are not commercially available, and there are no good estimates of their error rates. But their very sensitivity makes false positives likely, and when hundreds or thousands of people are tested, as occurred at Dartmouth, false positives can make it seem like there is an epidemic.
“You’re in a little bit of no man’s land,” with the new molecular tests, said Dr. Mark Perkins, an infectious disease specialist and chief scientific officer at the Foundation for Innovative New Diagnostics, a nonprofit foundation supported by the Bill and Melinda Gates Foundation. “All bets are off on exact performance.”
Of course, that leads to the question of why rely on them at all. “At face value, obviously they shouldn’t be doing it,” Dr. Perl said. But, she said, often when answers are needed and an organism like the pertussis bacterium is finicky and hard to grow in a laboratory, “you don’t have great options.”
…
At Dartmouth the decision was to use a test, P.C.R., for polymerase chain reaction. It is a molecular test that, until recently, was confined to molecular biology laboratories.
…
https://health.maryland.gov/newsclippings/archives/2007/jan07/012207.htm#Faith_in_Quick_Test_Leads_to_Epidemic_That_Wasn%E2%80%99t
Sorry to keep banging on about this but I think it is of paramount importance. People seem determined to call the PCR process a “test” when the inventor said it wasn’t.
As you have pointed out, the authorities know this fact full well – that’s why they continue to use it.
I completely agree. It cannot detect a virus or a disease.
It detects a genetic code but as Sars Cov2 has never been isolated the test is meaningless.
To say someone is a case after getting a positive test is ludicrous.
“Sars Cov2 has never been isolated” Of course it has, it’s been sequenced repeatedly. And photographed.
I think you need to go back and get that verified. The purification process has never been done to show just virus particles.
They say it’s been isolated but it hasn’t.
An excellent, well reasoned, well documented article. What surprises me isn’t that the same people who swallowed the “Russiagate” or the “Skripal” nonsense peddling now are also foaming at the mouth, rabid, mask-wearing, covid-hysterics – but that so many otherwise skeptical voices in alternative media seem incapable of even basic critical thinking and reporting on the matter.
One might think that the overall MSM and social media censorship, i.e. Facebook, Youtube and Twitter – of Nobel winners in science would alone raise eyebrows among those whose goal it is to question State propaganda narratives, but instead only a relative handful of alternative media sites like this one are doing actual critical reporting.
It is very odd indeed to find that alt-media voices I trusted to honestly dismantle Russiagate remain conspicuously silent or absurdly non-committal regarding the equally irrational and evidence-free covid-hysteria.
Do you really see ‘the State’ as the villain of ‘propaganda narratives’? Because I find it extremely hard to believe that the all the fear, pandemic and severe measures to deal with wu-flu were welcome or rational choices by national governments. But it’s very easy to argue that governments like the UK’s have been dancing to the tune of big pharma, the WHO, Bill Gates and assorted other globalist interests with their huge control over the corporate media. The view that Boris and cabinet are gullible fools being played, rather than scheming wannabe dictators, is surely more likely, right? If so, then blaming your own government for our current plight really helps the globalists. BTW, you know that Gates funds the Guardian and the WHO, and is a big fan of Xi Jinping, right? All 4 of these parties hate Trump and want him out in November, especially communist China, whose militaristic ambitions and trade supremacism Trump has stymied, and whose concentration camps with 3m Muslims and Tibetans Trump has openly condemned (unlike the left). So do you prefer globalists Gates and XI to Trump?
Save your shtick for someone a bit more patient than I. While I will freely admit to the bad habit of sometimes actually enjoying jousting with trolls – the caveat is that they first have to post something at least reasonably rational and evidence based to make it at least interesting.
Yeah, China has warships right up the California coast the devils…
Seen the Chinese in action in HK, now under communist control? Even the BBC aired footage of the secret trains taking away hundreds of handcuffed protestors to unknown destinations. Maybe they are off to join the 3m Muslims and Tibetans in the CCP’s re-education camps, subject to torture, rape, murder, and organ harvesting. Imagine violent Antifas and BLM rioters being treated like that in the US! Democrat states and judges keep releasing them faster than the cops can arrest them, and then attack the cops as racists. By contrast, Chinese cops and prison guards get to gang rape their victims with official blessings. Then there is the hugely expanding Chinese army, itching to invade the free nation of Taiwan, whose 23m citizens no doubt wish they could relocate to CaliforniA ASAP. Meanwhile, the eradication of Christianity, Islam, Falang Gong and other undesirable religious minorities groups continues to intensify as the Chinese dictatorship continues to tighten its control over every single subject. No human rights and freedoms under communism. And no other nation more resembles the rise of Nazi Germany and the even worse Soviet Union. But hey, we all know the evil Americans caused it all.
If one believes that Epstein was using pedophilia to blackmail powerful people, then one also has to believe that some people are doing things in response to blackmail. Boris started off wanting to respond in a tradition way (protect the most vulnerable etc) then changed his mind to go along with all the majority of other countries in the world. Could he have been blackmailed? My view is that blackmail is probably the most likely reason for him to change from conservative to Jezza-left socialist overnight.
It’s almost as if their previous acuity has somehow made them more susceptible to the psy-op. Many have been silent or non-commital (Pilger, Jonathan Cook, Chomsky, LRB reviewers/editors etc.) Meanwhile, Moon of Alabama,Media Lens and Greg Philo present with full Covid Derangement Syndrome; I don’t understand it either.
I find myself wondering if folks who depend upon their platform for part of their income, (otherwise great voices like a Jimmy Dore or Caitlin Johnstone), find themselves (perhaps even unconsciously) not addressing covid critically due to very realistic fears of being de-platformed and effectively disappeared? It’s hard to know. I don’t understand it either.
Individual voices are easily identified and can be/have been targeted in numerous ways akin to the TV series Burn Notice… Paypal, Visa, cancelled, IRS investigations, Internet service provider ordered to drop them, web site host likewise.
In short order that can be escalated, if the target is high profile/persistent enough to warrant personal harassment/ tailing the kind of treatment apparently meted out to Gary Webb, Milton William “Bill” Cooper, Mae Brussell, Danny Casolaro, Andrew Breitbart, Michael Ruppert, Michael Hastings, David McGowan and many, many more.
Even if you believe large numbers of thorns-in-the-side can spontaneously develop fast-acting cancer or habits of driving into trees or a predilection for double-shot suicides — and for this to happen to their loved ones in the preceding years — the degree of harassment these individuals received would have been a contributing factor to their stress, loss of income and loss of will.
Which is of course an unfortunate coincidence.
Yes, too few sites now as some seem to have shown their true colours with the virus scam.
Lew Rockwell is pretty good.
Johnstone is a hard-core left wing author who is as integrated into the left wing victim culture as any I have read. She suffers from the same weak minded insecurities of all victimised left wing fanatics, in the same political genre as the modern Aussie feminism movement, the man-hating movement, a despicable movement if ever there was one. The movement that even cancelled Germaine Greer, another guilty party who helped to bring us to the pathetic state of Australia today. Johnstone’s is abandoning her readership in order to support the authoritarian left-wing policies destroying the economy. I wouldn’t expect anything less now that she has been revealed to all as a charlatan.
I will admit that just recopied what I’m posting below from my earlier response in this thread to yet another troll-boy but it seems to fit just fine:
“Save your shtick for someone a bit more patient than I. While I will freely admit to the bad habit of sometimes actually enjoying jousting with trolls – the caveat is that they first have to post something at least reasonably rational and evidence based to make it at least interesting.”
But hey, maybe you already got this message earlier?
Wow, your arogant superiority shines though. Is that what you used to do to the savages when you were the white man giving them their rights? Did you make them beg? Left wing waste of space, but unfortunately your lot are in the ascendance, destroying the modern world. No wonder you are so smug.
To quote Shakespeare:
“the troll-boy doth project too much, me thinks!”
Well, something like that.
“Who could have known?”
Look, hardly anyone extra has died here. “Give me my life back, Mommy!” So I can continue in the courageous pursuit of the key goal in life: the bliss, joy, and human fullness of the eudaimonia of a private independent personal identity and primordial health of privatised property; mediated by money. And let us not mention the conscience-free consumption lifestyles that have caused the naturalised justice of slavery and privation of life in the Global South ever again.
Did I forget something? All the elephants and Northern White Rhinos missing in the room?
This is typical of the ontological oncology and overcoma I have been reading since Coronae woke the comatose to the realities of the Misanthropic Co-Extinction event we have been perpetrating with our gross negligent and belligerent indifference to all lifestyles: except our own. We are the problem. Now I can see why. Everyone who reads this will be in the world’s top group of overconsumers. Not because we are that rich: but because we have made everyone else that poor.
We just don’t get it, do we?
I don’t. What did you say?
That commenter’s job is to lead one on an incomprehensible Wild Goose Chase,
and I’m guessing it’s well paid (or something) to do so.
The Global South is suffering the most from this global lockdown. This is not a case of “old normal” good, “new normal” bad, but rather, the “new normal” is even worse than the “old normal” for the Global South. North-South economic relations have always been grossly exploitative and unjust, but the “new normal” is not going to improve those relations in the least. Mass poverty and starvation are increasing as a result of the lockdown.
There needs to be some context to the “Covid death” figures here- as scant as they are in this article once placed into a deeper context “Covid deaths” disappear into the near zero range in all age groups.
The first additional piece that should be included is underlying conditions, serious pre-existing health conditions. Place this into the picture and subtract those out.
The next is the differentiation between dying “from” or “with.” Let’s subtract those out.
The next is those that were listed as “presumed.” Let’s subtract those out.
The next are the “at home” deaths that were placed in the lump sum, catch-all Covid category. Subtract those out.
The next is those from nursing homes that were killed by policy changes not a moonshot viral contagion per se. Subtract those out.
The next is those who were killed by medical malpractice (improper use of ventilators e.g.). Subtract those out.
I’m sure I have missed a few categories that others here can add into the kitty of non-Covid deaths marked as Covid deaths- but you get the picture.
I still challenge anyone to send me a single example of a healthy individual that has died from the dreaded virus to end all virii. Been doing that for months with dozens of people and not a single respondent has been able to do so. During a pandemic of this stature by now I should have a list of several thousand. Not a one to date.
…- Funny how Colds, Flu and Pneumonia cases have ‘*virtually’disappeared*’, tho’ innit?…
😉
It’s a tangent, but I saw a comment somewhere lamenting that airlines were adding COVID-related procedures to the already-onerous airport rigamarole.
The commenter was a frequent flyer (I’m a non-flyer), and was understandably aggravated that new complications were introduced in addition to the TSA-imposed “security” procedures. He asked rhetorically why it was still so important to require that shampoo or toothpaste be transported in small containers– was that restriction ever going to be abolished?
“Hey, where did ‘terrorism’ go?” suddenly flashed into my mind. Remember when all of the draconian security measures were imposed to ensure that “they” didn’t come over “here” to do “us” in? We never hear about encroaching terrorists any more. What changed? Did all the terrorists succumb to the Megadeath Virus of Doom?
Of course, I do realize that the authorities would use the “magic rock that keeps away tigers” rationale to pretend that they’d solved or cured the terrorism threat by imposing the bogus draconian restrictions.