COVID19 – Evidence Of Global Fraud
Iain Davis
COVID 19, and the subsequent governmental responses, appear to be part of an international conspiracy to commit fraud. It seems there is no evidence that a virus called SARS-CoV-2 causes a disease called COVID 19.
Sometimes you have to go with your gut. I am not an expert in genetics and, as ever, stand to be corrected. However my attention was drawn to some research published by the Spanish medical journal D-Salud-Discovery. Their advisory board of eminently qualified physicians and scientists lends further credibility to their research. Their claim is astounding.
The genetic primers and probes used in RT-PCR tests to identify SARS-CoV-2 do not target anything specific. I followed the search techniques outlined in this English translation of their report and can corroborate the accuracy of their claims about the nucleotide sequences listed in the World Health Organisations protocols. You can do the same.
D-Salud-Discovery state there are no tests capable of identifying SARS-CoV-2. Consequently, all claims about the alleged impact of COVID 19 on population health are groundless.
The entire official COVID 19 narrative is a deception. Ostensibly, there is no scientific foundation for any part of it.
If these claims are accurate we can state that there is no evidence of a pandemic, merely the illusion of one. We have suffered incalculable loss for no evident reason, other than the ambitions of unscrupulous despots who wish to transform the global economy and our society to suit their purposes.
In doing so this “parasite class” have potentially committed countless crimes. These crimes can and should be investigated and prosecuted in a court of law.
Identification of What Exactly?
The World Health Organisation (WHO) classified COVID-19 (COronaVIrus Disease 2019). They declared a global COVID 19 pandemic on March 11th 2019.
The WHO’s Laboratory testing guidance states:
The etiologic agent [causation for the disease] responsible for the cluster of pneumonia cases in Wuhan has been identified as a novel betacoronavirus, (in the same family as SARS-CoV and MERS-CoV) via next generation sequencing (NGS) from cultured virus or directly from samples received from several pneumonia patients.”
The WHO’s claim is that the SARS-CoV-2 virus causes the disease COVID-19. They also allege this virus has been clearly identified by researchers in Wuhan.
In the WHO’s Novel Coronavirus 2019-nCov Situation Report 1, they state:
The Chinese authorities identified a new type of coronavirus, which was isolated on 7 January 2020……On 12 January 2020, China shared the genetic sequence of the novel coronavirus for countries to use in developing specific diagnostic kits.”
These two statements from the WHO clearly suggest the SARS-CoV-2 virus was isolated (meaning purified for study) and then genetic sequences were identified from the isolated sample. From this, diagnostic kits were developed and distributed globally to test for the virus in towns, cities and communities around the world. According to the WHO and Chinese researchers, these tests will find the virus that causes COVID 19.
Yet the WHO also state:
Working directly from sequence information, the team developed a series of genetic amplification (PCR) assays used by laboratories.”
The Wuhan scientists developed their genetic amplification assays from “sequence information” because there was no isolated, purified sample of the so called SARS-CoV-2 virus. They also showed electron microscope images of the newly discovered virions (the spiky protein ball containing the viral RNA.)
However, such protein structures are not unique. They look just like other round vesicles, such as endocytic vesicles and exosomes.
Virologists claim that it is not possible to “isolate” a virus because they only replicate inside host cells. They add that Koch’s postulates do not apply because they relate to bacteria (which are living organisms). Instead, virologists observe the virus’ cytopathogenic effects (CPE), causing cell mutation and degradation, in cell cultures.
When Chinese researchers first sequenced the full SARS-CoV-2 genome they observed CPE in Vero E6 and Huh7 cells. Vero E6 are an immortalised monkey cell line and Huh7 are immortalised cancer (tumorigenic) cells. Meaning they have been maintained in vitro (in petri dish cultures) for many years.
Central to the official SARS-CoV-2 story is the idea that it is a zoonotic virus, capable of bridging the species gap from animals to humans. When scientists from the US CDC “infected” various cells with the novel virus they noted the following:
We examined the capacity of SARS-CoV-2 to infect and replicate in several common primate and human cell lines, including human adenocarcinoma cells (A549) [lung celles], human liver cells (HUH7.0), and human embryonic kidney cells (HEK-293T), in addition to Vero E6 and Vero CCL81 [monkey cells]…No cytopathic effect was observed in any of the cell lines except in Vero cells [monkey cells]…HUH7.0 and 293T cells showed only modest viral replication and A549 cells [human lung tissue cells] were incompatible with SARS-CoV-2 infection.”
The CDC did not observe any CPE in human cells. They saw no evidence that this alleged virus caused any human illness. Nor did this supposed human virus show any notable replication in human cells, suggesting human to human infection would be impossible.
Noting this problem, a team of Polish scientists introduced this sequenced “virus” to human epithethelium (airway) cells. They observed the effects on these HAE cultures for 5 days. They noted much greater replication than the CDC scientists but ultimately stated:
“We did not observe any release of the virus from the basolateral side of the HAE culture.”
Meaning they did not see any evidence of the supposed virions breaching the cell wall membrane. Again suggesting this so called virus isn’t infectious in human beings.
It is not clear that SARS-CoV-2 is a human virus capable of causing illness. It may not even physically exist. Is it nothing more than a concept based upon predictive genetic sequences?
Voyage Of Discovery
The Wuhan Center for Disease Control and Prevention and the Shanghai Public Health Clinical Centre published the first full SARS-CoV-2 genome (MN908947.1 ). This has been updated many times. However, MN908947.1 was the first genetic sequence describing the alleged COVID 19 etiologic agent (SARS-CoV-2).
All subsequent claims, tests, treatments, statistics, vaccine development and resultant policies are based upon this sequence. If the tests for this novel virus don’t identify anything capable of causing illness in human beings, the whole COVID 19 narrative is nothing but a charade.
The WUHAN researchers stated that they had effectively pieced the SARS-CoV-2 genetic sequence together by matching fragments found in samples with other, previously discovered, genetic sequences. From the gathered material they found an 87.1% match with SARS coronavirus (SARS-Cov). They used de novo assembly and targeted PCR and found 29,891-base-pair which shared a 79.6% sequence match to SARS-CoV.
They had to use de novo assembly because they had no priori knowledge of the correct sequence or order of those fragments. Quite simply, the WHO’s statement that Chinese researchers isolated the virus on the 7th January is false.
The Wuhan team used 40 rounds of RT-qPCR amplification to match fragments of cDNA (complimentary DNA constructed from sampled RNA fragments) with the published SARS coronavirus genome (SARS-CoV). Unfortunately it isn’t clear how accurate the original SARS-CoV genome is either.
In 2003 a team of researchers from from Hong Kong studied 50 patients with severe acute respiratory syndrome (SARS). They took samples from 2 of these patients and developed a culture in fetal monkey liver cells.
They created 30 clones of the genetic material they found. Unable to find evidence of any other known virus, in just one of these cloned samples they found genetic sequences of “unknown origin.”
Examining these unknown RNA sequences they found 57% match to bovine coronavirus and murine hepatitis virus and deduced it was of the family Coronaviridae. Considering these sequences to suggest a newly discovered SARS-CoV virus (new discoveries being ambrosia for scientists), they designed RT-PCR primers to test for this novel virus. The researchers stated:
Primers for detecting the new virus were designed for RT-PCR detection of this human pneumonia-associated coronavirus genome in clinical samples. Of the 44 nasopharyngeal samples available from the 50 SARS patients, 22 had evidence of human pneumonia-associated coronavirus RNA.”
Half of the tested patients, who all had the same symptoms, tested positive for this new alleged virus. No one knows why the other half tested negative for this novel SARS-CoV virus. The question wasn’t asked.
This supposed virus had just a 57% sequence match to allegedly known coronavirus. The other 43% was just “there.” Sequenced data was produced and recorded as a new genome as GenBank Accession No. AY274119.
The Wuhan researchers subsequently found an 79.6% sequence match to AY274119 and therefore called it a novel strain of SARS-CoV (2019-nCoV – eventually renamed SARS-CoV-2). No one, at any stage of this process, had produced any isolated, purified sample of any virus. All they had were percentage sequence matches to other percentage sequence matches.
Isolate Nothing
Scientists are very annoyed because they keep saying the virus has been isolated but no one believes them. This is because, as yet, no one has provided a single purified sample of the SARS-CoV-2 virus. What we have instead is a completed genome and, as we are about to discover, it isn’t particularly convincing.
Investigative journalists Torsten Engelbrecht and Konstantin Demeter asked some of the scientists who said they had images of SARS-C0V-2 virions to confirm these were images of an isolated, purified, virus. None of them could.
In Australia scientists from the Doherty Institute, announced that they had isolated the SARS-CoV-2 virus. When asked to clarify the scientists said:
“We have short (RNA) sequences from the diagnostic test that can be used in the diagnostic tests”
This explains why the Australian government state:
The reliability of COVID-19 tests is uncertain due to the limited evidence base…There is limited evidence available to assess the accuracy and clinical utility of available COVID-19 tests.”
In The UK, in July, a group of concerned academics wrote a letter to the UK Prime Minister Boris Johnson in which they asked him to:
Produce independently peer reviewed scientific evidence proving that the Covid-19 virus has been isolated.”
To date they have not received a reply.
Similarly, UK researcher Andrew Johnson made a Freedom of Information Request to Public Health England (PHE). He asked them to provide him with their records describing the isolation of a SARS-COV-2 virus. To which they responded:
PHE can confirm it does not hold information in the way suggested by your request.”
Canadian researcher Christine Massey made a similar freedom of information request, asking the Canadian government the same. To which the Canadian government replied:
Having completed a thorough search, we regret to inform you that we were unable to locate any records responsive to your request.”
In the U.S. the Centre For Disease Control (CDC) RT-PCR Diagnostic Panel state:
…No quantified virus isolates of the 2019-nCoV are currently available……..Detection of viral RNA may not indicate the presence of infectious virus or that 2019-nCoV is the causative agent for clinical symptoms.”
Last updated on 13th July 2020, the CDC are yet to obtain any pure viral sample from any patient said to have the disease of COVID-19. They openly admit their tests don’t necessarily show if SARS-CoV-2 is either present or causes COVID 19.
We are told that none of this matters. That we are ignorant and just don’t understand virology. Therefore, we must accept pictures of things we know could be something else and genetic sequences (which could be anything else) as conclusive proof that this virus, and the disease it is supposed to cause, are real.
Testing For Nothing
The WHO, and every government, think tank, policy steering committee, government scientific advisor, supranational institutions and others who promote the official COVID 19 narrative, assert that SARS-CoV-2 causes COVID 19.
While no one has ever produced a sample of this supposed virus, the alleged SARS-CoV-2 genome has been published. It is in the public domain.
Key genetic sequences, in the SARS-CoV-2 genome, are said to have specific functions. These are the target proteins that scientists test for to identify the presence of the “virus”. These include:
- RNA-polymerase (Rd-Rp) gene – This enables the SARS-CoV-2 RNA to replicate inside the cytoplasm of COVID 19 diseased epithelial cells.
- S gene (Orf2) – this glycoprotein forms the spike on the SARS-CoV-2 virion surface which supposedly facilitates SARS-CoV-2 binding to the ACE2 receptors on cells, allowing the RNA inside the virion protein shell (capsid) to pass into the now infected cell.
- E gene (Orf1ab) – small membrane protein used in viral assembly
- N gene (Orf9a) – the nucleocapsid gene which binds the RNA in capsid formation
The WHO maintain a publicly available record of the RT-PCR primers and probes used to test for SARS-CoV-2. The primers are specific nucleotide sequences that bind (anneal) to the antisense and sense strands of the synthesised cDNA (called forward and reverse primers respectively.)
The cDNA strands separate when heated and reform when cooled. Prior to cooling, nucleotide sequences called probes are introduced to anneal to specific target regions of the suspected viral genome. During amplification, as the regions between primers elongate, when a primer strikes a probe, the probe decays releasing a fluorescent or dye which can then be read by researchers.
It is the identification of these markers which scientists claim to prove the presence of SARS-CoV-2 in a sample.
Something else which is publicly available is the Basic Local Alignment Search Tool (BLAST). This allows anyone to compare published nucleotide sequences with all those stored by the U.S. National Institutes of Health (NIH) genetic database called GenBank. Therefore we can BLAST the claimed SARS-CoV-2 primers, probes and target gene sequences.
The WHO’s forward, reverse primers and probe protocols, for the alleged SARS-CoV-2 viral genome, are based upon RdRp, Orf1, N and E gene profiles. Anyone can run them through BLAST to see what we find.
The vital RdRP nucleotide sequence, used as a forward primer is – ATGAGCTTAGTCCTGTTG. If we run a nucleotide BLAST this is recorded as a complete SARS-CoV-2 isolate with a 100% matched sequence identity. Similarly the reverse E gene primer sequence – ATATTGCAGCAGTACGCACACA – reveals the presence of the Orf1ab sequence which also identifies SARS-CoV-2.
However, BLAST also enables us to search the nucleotide sequences of the microbial and human genomes. If we search for the RdRp SARS-CoV-2 sequence it reveals 99 human chromosome with a 100% sequence identity match. The Orf1ab (E gene) returns 90 with a 100% sequence identity match to human chromosomes.
Doing the same for these sequences with a microbial search finds 92 microbes with a 100% match to the SARS-CoV-2 E gene and 100 matched microbes, with a 100% sequence identity, to the vital SARS-CoV-2 RdRp gene.
Whenever we check the so-called unique genetic markers for SARS-CoV-2, recorded in the WHO protocols, we find complete or high percentage matches with various fragments of the human genome. This suggests that the genetic sequences, which are supposed to identify SARS-CoV-2, are not unique. They could be anything from microbial sequences to fragments of human chromosomes.
So called fact checkers, like Reuters’ Health Feedback project, have been quick to dismiss the claims of those who have noticed the apparent lack of specificity in the supposed SARS-CoV-2 genome.
Using a slew of strawman arguments like, “this claim suggests every test should be positive,” (which it doesn’t) their debunking attempt runs something like this:
Primers are designed to bind to specific nucleotide sequences that are unique to the virus. The forward primer may bind to a particular chromosome but the reverse primer doesn’t bind to the same chromosome and so the chromosome is not present in the SARS-CoV-2 virus. Moreover because the forward and perverse primers envelop the sequence to be amplified the cDMA sequence between primers is unique to the virus.
This seems to deliberately misrepresent the significance of these findings by forwarding an argument that no one, other than the fact checkers themselves, are making. BLAST searches show that these target sequences are not unique to SARS-CoV-2. Nor do all targets need to be found for a result to be deemed positive.
Moroccan researchers investigated the epidemiology of Moroccan alleged cases of SARS-CoV-2. Nine percent were positive for three genes, eighteen percent were positive for two genes and seventy three percent for just one. As we have just discussed, many may have been positive for none.
This is entirely in keeping with WHO’s test guidelines. They state:
“An optimal diagnosis consists of a NAAT [nucleic acid amplification test] with at least two genome-independent targets of the SARS-CoV-2; however, in areas where transmission is widespread, a simple single-target algorithm can be used……One or more negative results do not necessarily rule out the SARS-CoV-2 infection.”
Regardless of the spurious arguments of well funded fact checkers, if the forward and reverse primers identify junk, perhaps one being the fragment of a chromosome and the other a microbial sequence, then the amplified region between them is probably junk too.
The argument that RT-PCR only finds RNA is specious. Natural transcription (the separation of DNA strands) occurs during gene expression. No one is saying whole chromosomes or microbes are sequenced in the alleged SARS-CoV-2 genome. Though they may, for all we know. They are saying the alleged markers, used to test for this supposed virus, are not fit for purpose.
RT-PCR tests do not sequence the entire genome. They look for incidents of specific probe florescence to indicate the presence of sequences said to exist. These sequences are defined by MN908947.1 and the subsequent updates. These primers and probes could reveal nothing but RNA matches extracted from non-coding, sometimes called “junk,” DNA (cDNA.)
For example the SARS-CoV-2 S gene is meant to be highly specific to the SARS-CoV-2 virus genome. The target sequence is – TTGGCAAAATTCAAGACTCACTTTC. A microbial BLAST search returns 97 microbial matches with 100% identity sequence match. The lowest identity percentage match, within the top 100, is 95%. A human genome BLAST also finds a 100% sequence match to 86 human chromosome fragments.
No matter where you look in the supposed genome of SARS-CoV-2, there is nothing in the WHO’s test protocols that clearly identifies what it is. The whole genome could be false. The tests do not prove the existence of SARS-CoV-2. All they reveal is a soup of unspecified genetic material.
If so, as there are no isolates or purified samples of the virus, without a viable test, there is no evidence that SARS-CoV-2 exists. Therefore, nor is there any evidence that a disease called COVID 19 exists.
This infers that there is no scientific basis for any claims about COVID 19 case numbers, hospital admissions or mortality figures. All measures taken to combat this deadly virus are quite possibly founded upon nothing.
Conclusive Fraud
Fraud is a criminal act. The legal definition of fraud is:
“Some deceitful practice or willful device, resorted to with intent to deprive another of his right, or in some manner to do him an injury.”
The Legal definition of a conspiracy is:
“A combination or confederacy between two or more persons formed for the purpose of committing, by their joint efforts, some unlawful or criminal act”
It seems, those who claim we face a pandemic have not provided any evidence to show that a virus called SARS-CoV-2 causes a disease called COVID 19. All of the information strongly suggesting this possibility is readily available in the public domain. Anyone can read it.
For there to be a fraud the deceit must be wilful. The intention must be to deliberately deprive others of their rights or injure them in some other way. If there is evidence of collusion between individuals ad/or organisations to commit fraud, then this is a conspiracy (in Common Law jurisdictions) or a Joint Criminal Enterprise (JCE) under International Law.
It seems COVID 19 has been deliberately used as a casus belli to wage war on humanity. We have been imprisoned in our own homes, our freedom to roam restricted, freedom of speech and expression eroded, rights to protest curtailed, separated from loved ones, our businesses destroyed, psychologically bombarded, muzzled and terrorised.
Worse still, while there is no evidence of unprecedented all cause mortality, there were unseasonable spikes in deaths. These correlate precisely with Lockdown measures which saw the withdrawal of the health services we pay for and a reorientation of public health services to treat one alleged disease at the exclusion of all others.
Further, it is proposed by those who have forwarded the COVID 19 story, that this alleged disease provides justification for the complete restructuring of the global economy, our political systems, societies, cultures and humanity itself.
To be allowed to participate in their so called “new normal,” which is the wholesale transformation of our entire society without our consent, they insist we submit to their conditions.
These include, but aren’t limited to, bio-metric surveillance of everyone, the centralised control and monitoring of all of our transactions, oppressive business and social restrictions and an effective demand that we have no right to sovereignty over our own bodies. This constitutes the condition of slavery.
There is no doubt that we have been deprived of our rights and injured. In Common Law jurisdictions innocence is presumed, but the evidence that harm has been deliberately caused by an international conspiracy is overwhelming. Destructive policies, enacted by governments across the world, clearly originated among globalist think tanks and supranational institutions long before the emergence of this non existent pandemic.
In Napoleonic Code jurisdictions, guilt is presumed. In order for the accused conspirators to prove their innocence they must show that, despite their immeasurable resources, they have collectively been unable to access or understand any of the freely available evidence suggesting COVID 19 is a myth.
Those responsible for the crime of conspiracy to commit global fraud should be tried. If found guilty they should be imprisoned while the rest of us get on with trying to repair the damage they have already inflicted.
SUPPORT OFFGUARDIAN
If you enjoy OffG's content, please help us make our monthly fund-raising goal and keep the site alive.
For other ways to donate, including direct-transfer bank details click HERE.
The world’s psychopathic élites realised, from the Victorian era, that they could secretly mass-cull populations, once the technology of vaccines was sufficiently advanced. At that time, ‘smallpox’ (which, like all ‘viruses’, does not exist) vaccination was compulsory on pain of a £1 fine (US$187 adjusted to 2023). Non-payers were subject to seizure of goods or imprisonment. ‘Smallpox’ was merely the physical manifestation of malnutrition and unsanitary living conditions of the day.
According to the élites’ perverted belief system, 2020 was to be the numerological date of their ‘final solution’ to reduce human numbers (by 93%) from 8 billion to the 500 million objective engraved on the Georgia guidestones.
https://www.theatlantic.com/health/archive/2015/07/victorian-anti-vaccinators-personal-belief-exemption/398321/
TheRosenauExperiment-1918-1919.html
‘THEY’ knew that viral contagion was false ever since mis-naming the ‘Spanish Flu’ 105 years ago. The true causes of sickness were the crude, typhoid vaccines of the day, combined with exposure of naîve populations to novel, broadcast-radio transmissions worldwide. That is why ‘outbreaks’ occurred concurrently, thousands of miles apart — before steamships could even convey the alleged ‘carriers’.
This set the stage for a repeat ‘plandemic’ of toxic injections and cellular radiation, a century later. Between 1.0 and 1.5 billion will have their lives foreshortened, or never be born, as a consequence. Look around and you will see crazy Karens & Kevins, ‘vaccidents’, vaccine-shedding/resonance effects, acute cancers, blood clots and myocarditis.
After 2026, Nuremberg 2.0 will be set in train.
By March of 2020, 70 nations had locked down. Nothing travels this fast.. Except slavish obedience to controllers – preconditioned in their appointed world rulers. Credit goes to Alexander Lukashenko, the only head of state that this writer knows about who refused the $800,000,00 bribe from the globalists – declining to sell out his nation. My son was studying there in 2021.. no masks, no mandates.. life as life should be. Hat’s off to Lukashenko. What does that say about the rest of the world though?
With this overwhelming and still growing mountain of scientific evidence, who (in lower case) is going to tell the WHO (in upper case) that the emperor is stark naked?
March 11th W.H.O. claimed COVID-19 8 months before Outbreak in China?
why is the rest of the web say it was not March 11 2019.
One would think that if the Wuhan Lab went to all the trouble to produce the novel corona virus that they could have isolated it, too. So many conspiracies, so little time. Mind you, our overlords, lizards or big pharma, mean (big) business.
This article is now more than a year old and yet nothing has changed from the standpoint of producing proof that this “pandemic” is due to a virus. Of course, life for the Profane (that’s you and me opposed to the blue-bloods and the other demon possessed behind this agenda) has become much worse with the advent of their poisonous vaccine. No doubt, we are experiencing a pandemic, but the disease is mass psychosis.
The Planet Lockdown video is on point: COVID-19 is intentional and purposeful There’s more to this conspiracy that meets the eye. There is a big picture. The big boys have a plan–a 500 year plan: 1776+500=2276CE. And the midpoint of their plan is just 5 years away in 2026, the year the USA celebrates 250 years of sovereignty.(Will they reach their goals?). The online book 2276CE: The Future is Calling (2020) outlines The Plan. That is, The Plan will abrogate the future of the whole world. We are simply living in the midst of its unfolding.
printing mistake…. “The World Health Organisation (WHO) classified COVID-19 (COronaVIrus Disease 2019). They declared a global COVID 19 pandemic on March 11th 2019.” I thought it was March 2020 (not 2019)
Excellent insight Iain, backed up by Kary B. Mullis
The Nobel Prize in Chemistry 1993
Prize motivation: “for his invention of the polymerase chain reaction (PCR) method.”
‘If they could find this Virus in you at all, PCR if you do it well
you can find almost anything in anybody’ 1.46 seconds Video
https://www.bitchute.com/video/MKw4paMg9Dij/
This is being orchestrated at the UN & WHO surprisingly above international Law.
Its 1958 WHO & UN Established. UN International Charter any agency controlled by them is also above international Law.
https://www.un.org/en/sections/what-we-do/uphold-international-law/
Frances Leader got the following reply from the UK MHRA on 21 December 2020:
“The DNA template (acute respiratory syndrome coronavirus2,GenBank: MN9089473) was generated via a combination of gene synthesis and recombinant DNA technology”
I published screen shots of government email in the ‘Covid Vaccine Development’ chapter on
https://HealthTruth.info/covid-vaccine/#development
Good morning Ralph, Frances was systematically removed from Twitter for her exposéwhich speaks volumes.
Gene
The Human achilles heel is his or her inability to create what they need in house in order to survive, as each free trade ageement was established and signed into law our true pain began to take place.
As our creativity and mechanical prowess was re-distibuted via these FTA’s our wherewithall began to slowly create the bery system that we all bought into on the cheap, you see there is no excuse not to use our own raw materials like iron and other metals in house,
CNC machines cost the same to run wherever they function, they need no wages not holidays, so why not bring this part of a myriad of manufacturing processes back home.
The reason why is to weaken one economy and enslave another by the same fations who run the world, reditribute the wealth and raw materials that the BDI index used to show.
If we do not get our creative arm back will will continue to die further, the service industry is already on it’s knees, what follows this is pure poverty for the majority, who’s hands used to be busy creating the very best quality in the world.
It is a clear as the summer sun, we are what we create and always live and die by the things we make.
Inversion really is a thing.
Shackled by FTA’s and treaties, imprisoned within a union.
According to tradition you had to sign a pact with the devil yourself.
Gotta love representational government.
All ‘viruses’ are a delusion in order to trick people into taking harmful vaccines. Politicians, from London to Manila to Washington, are being paid handsomely by the demonic, Malthusian, eugenicist bankers to promote this agenda. Like every blatant lie, it will shortly be exposed & even hard-line cognitive dissonants will be shaken to their core. The tragic side-effects of vaccination, just like for ‘swine flu’ in 1976, will become impossible to suppress …
https://hpv-vaccine-side-effects.com/covid-19-vaccine-side-effects-world-map/
“… it will shortly be exposed…”
Not according to event 201 it wont.
WHO is at Risk from COVID-19?
http://healthyprotocols.com/covid19%20mortality%20by%20age.png
Considering the EXTREME RISK of the untested mRNA “vaccines”; to “vaccinate” anyone under the age of 50 or so appears to me to be very unwise. Of course each person must make his OWN decision. NO ONE can evaluate your individual situation. Choose wisely. Forcing this untested crap on anyone under 50 SHOWS we are being RULED by genocidalists not governed by honest government.
this is full on near psychotic ranting. Absolute deriliction of all norms of communication. Go away and read some proper medical journals, some testimonies of actual medics some people who’ve had covid. Get back to reality
Your comment does not contain anything that would your support your assertions. You propose to have people read some proper medical journals, etc. but didn’t supply any suggestions.
Please state verifiable FACT; do not rant.
it has been well known since the beginning of the covid folks that PCR cannot… I repeat cannot diagnose anything
Good morning Elizabeth.
From the horses mouth..
Kary B. Mullis
The Nobel Prize in Chemistry 1993
Prize motivation: “for his invention of the polymerase chain reaction (PCR) method.”
‘If they could find this Virus in you at all, PCR if you do it well
you can find almost anything in anybody’
1.46 seconds Video
https://www.bitchute.com/video/MKw4paMg9Dij/
Been looking for this. Thanks.
You rant to much while providing nothing of substance.
Troll!!!!!
“Get back to reality”
I’ve heard this narrative before from some boomer who said something similar to me while talking about this pandemic nonsense, and I would not be surprised if Stephen Brown was a boomer himself. If he’s not, it makes no difference as the article on this page seem to have offended Mr. Brown’s sensibilities. Like others have said, provide some credible sources and maybe your rant would not have been in vain. If not, you sir can be the one to “go away”. Good day!
Crawl back into your hole, your way out of your depth..
Well I “had covid” but how do I know it was this SARS CoV 2? Yes, I still have antibodies against this S thing according to my last week’s lab result after infection 9 months previous. I had SOMETHING, there’s no doubt. I still don’t understand how something that produced mild influenza symptoms in me supposedly killed two of my coworkers, one of them young enough to be my child.
Were your coworkers put in the hospital on a vent and Remdesivir? That is why.
Here is the Nature Feb 2020 paper “finding” Sars-C2. They did not find a virus, purify anything, and so did not determine what the pathogen was. They only did metagenomics on a mixed lung wash containing billions of RNA fragments and referenced it to a data base:
https://doi.org/10.1038/s41586-020-2008-3
data bases cant find anything Novel, novel things arent in a data base. Hope you will come back to reality, no, on 2nd thoughts better you just stay crazy.
If I wanted to I could empathise with Mr. Brown because we have been promised
personal medicine for such a long time.
TPTB keep pushing futurism via genetical analysis and manipulation
through CRISPR.
But no long term risk assesments, the decision has been made to
in no circumstance ever go there.
The revolution not televised, the writing on the wall unread.
The destruction IS a controlled demolition.
Not so much psychotic but rather schizoid for deviation from the common narrative.
This absolute deriliction you speak of, what is that about?
“…testimonies of actual medics…”
Well, according to their behaviour on TikTok perhaps the scary panicdemic
was not that scary.
Ofcourse limiting healthcare resources to The Rona implies a deriliction of duty.
Does it not?
It’s far worse than dereliction of duty. It is part of the plan to maximize deaths to support the population plan. Also to Piss off enough folks for long enough that they will take expected violent action.
A Simple, 10-Point Disease & Remediation Summary
1). The existence of ‘viruses’, as contagious pathogens, is completely unproven by rigorous science.
2). ‘Viruses’ mimic known exosomes (necrotic cellular detritus) in size (30-150nm) & appearance.
3). ‘Viral Symptoms’ mimic cellular-detoxification effects, such as coughs and sneezes.
4). Spontaneous appearance is mistaken for contagion when many individuals in the same, toxic environment exhibit symptoms.
5). The symptoms are caused by cellular detoxification: usually as a result of chemical & radiation poisoning, accompanied by general malnutrition
6). Malnutrition is caused by deviation from our evolutionary, hunter-gather, animal-food-based diet.
7). Poisoning is caused by numerous insults: most-recently 4/5G (terrestrial & orbital), wi-fi, electric fields, chemtrails, glyphosates, fluoride, seed oils (Linoleic acid), grains, refined sugars, xenoestrogens & pharmaceuticals.
8). Opportunistic bacteria, parasites and fungi can be transmitted & take hold on unhealthy bodily terrain. This phenomenon is part evolutionary expansion, part ‘clean-up crew’.
9). The purpose of all faked viral ‘epidemics’ is to scare populations into taking ‘protective’ vaccines, directed by the Rothschild-Rockefeller-led medical-industrial complex, with full political and media connivance.
10). The real intention is to surreptitiously lower human populations on planet earth through general infertility, poisoning & outright genocide of the elderly. The psychopathic cabal views humanity as a plague destroying THEIR green planet. Vaccine manufacturers do not disclose the full ingredients, nor suffer any legal liability for their effects. Craftily time-limited compensation may be paid by governments but only a fraction of the damage will be remediated. We must use our strength-in-numbers to de-indoctrinate, re-educate & oppose their edict-driven, undemocratic fraud towards its inevitable collapse. Use this lesson to respect the environment (not through CO2-scams) & bring proven (but cabal-secreted), free-energy devices into general use to foster prosperity and population-stability.
Bravo! Trevor. Well said. 1 through 8 of your statement Sums up weeks of relentless searches I’ve just done. Blew my mind. I wasn’t expecting to find fraud. I just wanted to know what it was and understand how it worked. Didn’t expect or want to find it was the fake it clearly is.
Bro, commenting rules include citing your info.
Btw, the “chemtrails” thing is a crock. Yes, they did experimental seeding in the 50s but that doesn’t prove “chemtrails.” Contrails are not chemtrails. Prove chemtrails exist.
So it took place in the past but now there is nothing going on.
So the adding of new and previously not specified manner of cloud formations
is because of contrails.
Please take the next step and amuse this public by explaining how contrails
provide proof for the notion of white privilege.
(The Jetsons! They are white! And privileged!
… but so are the Rothschilds. OMG! White privilege antisemitic trope!)
https://www.geoengineeringwatch.org
If you are over 35 years old, you will remember the clear skies we used to enjoy. Beware: there is heavy counter-propaganda online from the cabal doing this.
Contrails are condensation that is of short duration.
Chemtrails, in the sky from horizon to horizon, following large high flying Jets are NOT Contrails.
The so called Chemtrails will slowly disperse in a somewhat billowing fashion over time…Looking like buckets of stuff dumped into slowly moving water, eventually covering the entire sky of the overflown area with a mist like appearance…that provides an obvious drop in temperature at ground level.
The other effects are observable when one walks out into the natural world. Something is Desiccating the Trees and other vegetation in the Rocky Mountains and also on the ranges along the East Coast. It is killing everything. Are these the Environmentalists? Same backers.
But, Right….what else is being dumped into the sky? Graphene Oxide???
You can look up a study on these effects provided by Nano Aluminum…online. Do your own Research, you’ll better be able to overcome your Cognitive Dissonance…and Hypnotic Programming ….which is another unbelievable…But, Very Real Thing. All devices, including TV are being used to emit Brain Entraining Frequencies to bring human Consciousness down to Suggestible levels…for programming. This IS NOT Mass Formation…and is ubiquitous. Look around.
Why is all of the insanity tolerated???
Protection through vaccines, the new and shiny R2P.
I hope the aliens don’t interfere and make a mess, winkwink.
Quality control should be a thing, yet it is not.
The customers have been demoted from kings to beggars.
The cabal just shot their last arrow and are now finished. Just takes a little time for the people to wake up to the scam … but they will never trust mainstream media and politicians again.
What we Do NOT Know about the Moderna mRNA COVID-19 vaccine
Folks we are being sold a pig in a poke. I have ABSOLUTELY no doubt this CRAP is going to KILL and damage a LOT of people; the question is only how BAD it will be; I fear it could be a LOT worse than most civilians can imagine. These “vaccines” are NOT Certified by the FDA to be safe and effective.
If you have read this document so far you should KNOW the benefits claimed by this CRAP are absolute BS.
http://healthyprotocols.com/2_corona_virus.htm
Makes me wonder how many people excluded in the trials then
have been included now because of the mandates.
Jon Bon Jovi: “-A shot in the arm, -And you’re to blame,
-You give vaccines -A bad name
Dr. Reiner Fuellmich and the Coronavirus Investigative Committee have prepared a class action for fraud and crimes against humanity. https://brandnewtube.com/v/7HiFEh
Do you believe the legal system is independent and us there to protect individuals or to control individuals and protect business and property wealth owners?
Great article. Thank you!
Can anyone adress this conclusion from the Polish study please?
“We did not observe any release of the virus from the basolateral side of the HAE culture.”
– “Meaning they did not see any evidence of the supposed virions breaching the cell wall membrane. Again suggesting this so called virus isn’t infectious in human beings.”
Please advise how the first statement gives that conclusion, having in mind that virus clearly increased on the apical side of the cell. Logically I would assume that the virus titer would be jumping in and out through the apical side, replicating itself through cells.
Why is there suddenly an overwhelming demand for ICU beds in Southern California? Why have funeral homes and crematoria been flooded with more business than they can handle? How do you account for the demand for mobile morgue units? How is it that other countries are also finding their public health systems overwhelmed? If this is a hoax, it is a remarkably convincing one.
Unvaccinated children around the world are healthier than unvaccinated children, especially in the US. Keep that in mind and stop drinking the kool aid. REAL THIS: Technocracy and the Great Reset
https://articles.mercola.com/sites/articles/archive/2020/12/19/technocracy-and-the-great-reset.aspx – 12/19/20 Mercola
“”The pandemic is part and parcel of the technocrats’ Great Reset that will usher in a whole new world of unimaginable restrictions on freedom. It has already accomplished a massive redistribution of wealth — again, from the middle class, from small business owners, to large multinational companies such as Amazon. The key technocrats are members of the Trilateral Commission: David Rockefeller, Henry Kissinger, Michael Bloomberg & Google heavyweights Eric Schmidt & Susan Molinari, vp for public policy at Google. From the media: David Ignatius, columnist for The Washington Post; David Sanger, chief Washington correspondent for The New York Times & Gerald Seib, executive editor at The Wall Street Journal. Other groups include Club of Rome, Aspen Institute, which groomed & mentored executives from around the world about subtleties of globalization. Many of its board members are also members of the Trilateral Commission,The Atlantic Institute, The World Economic Forum, The Brookings Institute and other think-tanks & other individuals such as Bill Gates & British Prime Minister Boris Johnson” Knowledge is power…
Dr. Paul Thomas Targeted By Medical Board & Media After Landmark Vaccine Study — Interview Note: Doctor Paul has some intelligent analysis of the extreme dangers of the mRNA “experimental vaccines”
http://healthyprotocols.com/Autism_Rates_Integrative_Pediatrics_News_and_Views.jpg
Andy Wakefield warns humanity about the coming wave of coronavirus vaccines
Marlene, good post. Please fix the typo for posterity… may detract from your message:
“Unvaccinated children around the world are healthier than
unvaccinated children.”Unless you can no longer edit.
Unvaccinated children around the world are healthier than unvaccinated children, especially in the US. Please keep that in mind. REAL THIS: “Technocracy and the Great Reset” – https://articles.mercola.com/sites/articles/archive/2020/12/19/technocracy-and-the-great-reset.aspx – 12/19/20 Mercola
“”The pandemic is part and parcel of the technocrats’ Great Reset that will usher in a whole new world of unimaginable restrictions on freedom. It has already accomplished a massive redistribution of wealth — again, from the middle class, from small business owners, to large multinational companies such as Amazon. The key technocrats are members of the Trilateral Commission: David Rockefeller, Henry Kissinger, Michael Bloomberg & Google heavyweights Eric Schmidt & Susan Molinari, vp for public policy at Google. From the media: David Ignatius, columnist for The Washington Post; David Sanger, chief Washington correspondent for The New York Times & Gerald Seib, executive editor at The Wall Street Journal. Other groups include Club of Rome, Aspen Institute, which groomed & mentored executives from around the world about subtleties of globalization. Many of its board members are also members of the Trilateral Commission,The Atlantic Institute, The World Economic Forum, The Brookings Institute and other think-tanks & other individuals such as Bill Gates & British Prime Minister Boris Johnson” Knowledge is power…
“If this is a hoax, it is a remarkably convincing one.”
This is not a hoax. What we have is a CRIMINAL Deadly Hoax organized at the national and international levels. IOW yes some deaths are being produced directly by the SARS-CoV-2 virus Bio Weapon, very few deaths, MOST “COVID-19 deaths” almost 99%, during the period from Feb 2020 to Sept 2020 were statistical FRAUDS.
What is happening in hospitals NOW is unclear to me. We will KNOW when the Total Mortality Data comes out; IF we get the HONEST Data. I would GUESS some real disease and death is being produced. I would give good odds that the 2020 -2021 “flu shot” was “juiced” to produce some death and destruction. Why do I believe this?
1) The CDC announced a couple of months ago that this flu season they would not being doing their NORMAL FLU SEASON TRACKING. To my knowledge they have NEVER done this. Now why would the CDC not perform their normal flu season surveillance? Why this year?
2) Hospitals are reporting they are not sending disease samples suspected as “flu” into the CDC for analysis.
3) The figures I have seen for influenza deaths and cases have been so LOW as to be ludicrous. How can anyone KNOW?
So I would GUESS many of the “COVID-19 cases” we see in hospital beds is ordinary influenza and corona virus. Where did it come from? The “flu shot”? This would not be the first time the “flu shot” has been “juiced”
Where are the COVID-19 Deaths?
The “COVID-19 Deaths” Have Been mostly a Massive Fraud
“Genevieve Briand, assistant program director of the Applied Economics master’s degree program at Johns Hopkins University, critically analyzed the impact that COVID-19 had on U.S. deaths. According to her, the impact of COVID-19 on deaths in the United States can be fully understood by comparing it to the number of total deaths in the country. According to study, In contrast to most people’s assumptions, the number of deaths by COVID-19 is not alarming. In fact, it has relatively no effect on deaths in the United States.” Covid-19 Deaths: A Look at U.S. Data
http://healthyprotocols.com/covid-19_deaths.jpg.jpg
CDC Data: Total Mortality from 02/01/2020 to 09/05/2020 Note please observe the Total Mortality has remained almost exactly the SAME. Although we supposedly had over 130,000 “COVID-19 deaths”
“After retrieving data on the CDC website, Briand compiled a graph representing percentages of total deaths per age category from early February to early September, which includes the period from before COVID-19 was detected in the U.S. to after infection rates soared.” Covid-19 Deaths: A Look at U.S. Data
http://healthyprotocols.com/image_John-Hopkins-Covid-study.jpeg
“Surprisingly, the deaths of older people stayed the same before and after COVID-19. Since COVID-19 mainly affects the elderly, experts expected an increase in the percentage of deaths in older age groups. However, this increase is not seen from the CDC data. In fact, the percentages of deaths among all age groups remain relatively the same… .” Covid-19 Deaths: A Look at U.S. Data
“When Briand looked at the 2020 data during that seasonal period, COVID-19-related deaths exceeded deaths from heart diseases. This was highly unusual since heart disease has always prevailed as the leading cause of deaths. However, when taking a closer look at the death numbers, she noted something strange. As Briand compared the number of deaths per cause during that period in 2020 to 2018, she noticed that instead of the expected drastic increase across all causes, there was a significant decrease in deaths due to heart disease. Even more surprising, as seen in the graph … , this sudden decline in deaths is observed for all other causes.” Covid-19 Deaths: A Look at U.S. Data
US Total Mortality remained the SAME before and after the “COVID-19 deaths”
In simple terms for each new “COVID-19 death” added to the Total Mortality number one death was SUBTRACTED from one of the categories of the Total Mortality number.
People receiving this UNTESTED “experimental vaccine” do not understand how FEW people (5% of “COVID-19 deaths”) are actually dying of the SARS-CoV-2 virus these “vaccines” are said to “protect” against.
http://healthyprotocols.com/2_corona_virus.htm
I don’t understand why the overall deaths from last year 2 this year is so much lower why is there less deaths in the United States this year than any other year
One reason may be due to the lockdowns there are fewer car accidents, workplace accidents, murders, etc. But that should be offset by deaths from illness which went untreated because people were afraid to go to the hospital, and because many caregivers themselves were not treating non-Covid illnesses.
I don’t know what the exact data is but if the reduction in accidents is greater than the increase in deaths from untreated illnesses, the total mortality would be lower this year.
Current stats for the top 3 causes of death in the US are roughly:
1) heart disease 655,000
2) cancer 600,000
3) accidents 167,000
probably propes, the tents are unused, they are there for show so are the refrigerated trucks, during the spanish flu people died in their homes some on the street this covid is the only one where you only die in hospital. very suspicious.
That is not true here in the UK
David, do you really expect us to account for all of the unsubstantiated hyperbole? According to a published study (later retracted) by Johns Hopkins University, there were no excess deaths in the US in 2020.
Globalist Klaus Schwab: World Will “Never” Return to Normal After COVID What does Klaus mean? Since almost all of the “COVID-19 deaths” are an epidemiological fraud this deadly scam can be kept going as long as we fall for it.
The total DAMAGE from Government policy far EXCEEDS, by many dozens of times, the damage from the actual health consequences from the virus SARS-CoV-2. Yes people are dying, especially after getting a “flu shot”, which the CDC is NOT tracking this season; how strange. BUT they are mostly dying of causes other than SARS-CoV-2, For example 30,000 of “COVID-19 deaths”; died of a Heart Attack.
We are basing our government policy, our economic policy and are restricting our basic human rights on completely wrong data and assumptions on the SARS-CoV-2 virus. If it were not for the “test results” that are daily reported in the corrupt MSM then it would be over because basically very little really happened.
Do the so called anti-corona measures such as the lockdowns, face masks, social distancing and quarantining serve to protect the world’s population from corona or do they serve other agendas? Item one on the agenda it to create FEAR.
The anti-corona measures whose only basis is the incorrect PCR test and other “quick tests” have harmed innumerable human lives and have destroyed the economic existence of countless companies and individuals world wide.
The PCR Test is being used used on the basis of false statements by highly placed health authorities, not based on scientific facts with respect to infection.
A positive “Test”, which establishes a “case”, does not mean any infection in present in the person tested. About 97% of positive tests are FALSE POSITIVES with no SARS-CoV-2 infection present in the tested person.
The test information coming with the PCR test kits state they are not to be used for diagnostic purposes. The CDC states the same thing, as does the inventor of the PCR method Doctor Kary Mullis.
The mortality of COVID-19 (3% of “COVID-19 deaths) is equivalent to that of the seasonal flu,
SARS-CoV-2 has not caused any excess morality anywhere in the world.
The German Government was massively lobbied by by the world’s Big Health Care establishment.
The German Government’s Interior Dept has published a report stating the population was deliberately driven to panic by politicians and the media. The honest person responsible for this important report was FIRED by the German government. This shows the corruption and crimes includes the German government. This firing of honest people for speaking truth about CON-19 is occurring in large entities all over the world.
Our, we the people, only out of this CON-19 is to LOSE our FEAR of SARS-CoV-2 and call out all the clowns promoting this FEAR. The best way to begin to do this is to learn a little about the fraudulent “PCR test”. All else will follow,
Those who can make you believe absurdities can make you commit autrocities.” Voltaire Note the chief atrocity they intend is to INJECT you and Yours with something you DO NOT WANT
“The difference between genius and stupidity is that genius has its limits.” Albert Einstein
After almost a year of the COVID-19 Deadly Hoax it is becoming increasingly clear how COVID-19 may fit into the Global Big Political picture.
COVID-19 is primarily a gambit by the NWO to radically advance their “Great Reset” agenda to Destroy National Sovereignty and run the world in an open Dictatorial manner instead of covertly as they largely do now. More power and wealth is to be concentrated in fewer hands.
http://healthyprotocols.com/2_corona_virus.htm
Great comment!! “The pandemic IS part and parcel of the technocrats’ Great Reset that will usher in a whole new world of unimaginable restrictions on freedom. It has already accomplished a massive redistribution of wealth — again, from the middle class, from small business owners, to large multinational companies such as Amazon. The key technocrats are members of the Trilateral Commission: David Rockefeller, Henry Kissinger, Michael Bloomberg & Google heavyweights Eric Schmidt & Susan Molinari, vp for public policy at Google. From the media: David Ignatius, columnist for The Washington Post; David Sanger, chief Washington correspondent for The New York Times & Gerald Seib, executive editor at The Wall Street Journal. Other groups include Club of Rome, Aspen Institute, which groomed & mentored executives from around the world about subtleties of globalization. Many of its board members are also members of the Trilateral Commission,The Atlantic Institute, The World Economic Forum, The Brookings Institute and other think-tanks & other individuals such as Bill Gates & British Prime Minister Boris Johnson”
Germ Theory is the linchpin in the Covid scam.
Amen!
Much of the Allopathic Medical Industry is based on the fraudulent “germ theory of disease”
“In a healthy body there is no room for disease. Disease results from an absence of health.” Udo Erasmus PhD
Disease Prologue
You must become academically interested in YOUR Health IMO. If you do not you will likely have a lot of “health problems” expenses and time wasting “health care” visits that are totally unnecessary. If you think I am kidding about the “Depopulation Agenda” you are incorrect. You MUST be aware of this powerful threat to your health and LIFE. There is so much disinformation and outright propaganda coming out of the CDC, HHS, the Medical INDUSTRY and BIG Pharma that if you do not know some basic Human Physiology and the true disease process you are going to be FOOLED into taking actions that will often harm you.
Most modern “disease” IMO in today’s USA is a result of eating man-made crap, sitting on our butts and accepting disease producing “medical advice”. Hard to accept knowledge; but we are ignoring it to our continuous demise. Note drugs and Medical Treatment will not help you solve this NUTRITIONAL, EXERCISE and KNOWLEDGE problem.
“There is much more money to be made by making people sick and treating that sickness with useless chemical medicines than there is to be made by healing people, and that is definitely unfortunate. Since before World War II, many associations, administrations, agencies and corporations have plotted and planned the total debasement of American food and medicine as an insidious means of getting rich and staying rich, and it worked. Still, most Americans believe these agencies and “non-profit” organizations would never be so evil and insidious.” Top 5 associations and organizations that invest in the destruction of the health of Americans
http://healthyprotocols.com/2_disease.htm
Has this information been updated? it is now December 13
Amid all the frustration of trying to inform the people around me – who just shut their ears – about the hoax that is taking place, I suggest this article as being perhaps THE best single article worth sharing. It truly gets to the heart of the matter.
Many of our near & dear are under extreme mind kontrol.
They no longer have full free will.
They may turn against you eventually, so be wary and prudent, all of you.
Peace.
The Invisible Rainbow
cheers
I will propose one possible narrative here. The 5G narrative :
Wuhan was the first city in China to launch 5G, right before the ‘outbreak.’
5G operating at 60 GHz deprives the body of oxygen, and inhibits its ability to absorb and use oxygen. ER Dr Kyle-Sidell in NYC describes ‘covid’ symptoms almost identical to these.
Prior to the lockdown, electromagnetic & health watchdog groups had been vigilant in blocking any attempted rollout of 5G without testing. Not the FCC nor any other telecom regulator in the world–each shamelessly captured by industry and the cult–has enforced the testing requirement, its most BASIC responsibility to the public.
The FCC is beholden to Big Telecom. Like the FDA is beholden to Big Food & Big Pharma. Like the EPA is beholden to Big Oil.
B*TCHES gettin TOO BIG FO DEY BRITCHES, and need to GET CUT DOWN.
While everyone was locked down, telecom operators worldwide were given the green light to roll out 5G, working 24-hour shifts to install the networks. In schools, in hospitals, in offices, etc. We had perfectly adequate 4G but somehow this was deemed essential work, even requiring triple shifts.
Almost all 5G networks active around the globe were deployed in H2 2019 and H1 2020, coinciding with the fake pandemic.
Because 5G has very short range, it requires transmitters every few hundred feet, or every few houses / buildings. The health consequences to all forms of life are devastating.
The links below point to the ample scientific studies on the crazy health impacts of EMF frequencies. To ALL FORMS OF LIFE, large and small.
But wait, there’s more.
Elon Musk, through his StarLink venture has this year deployed 700 satellites beaming 5G over most of planet Earth. He was also green-lighted during the pandemic, with a license to throw into orbit a total of 12,000 5G satellites and 10 million 5G ground stations.
You will note that Elon Musk also runs a company called NeuraLink, which aims at linking the human brain to AI.
The lockdowns were, in my view and thousands of others, a pre-planned to once and for sneak 5G through without protest or testing. Of course, this would be only one of many objectives encapsulated by the not-so-great reset.
Unlike previous network evolutions, the shift from 4G to 5G is a sea change in terms of technology, and in terms of health and psychological (and ultimately, maybe even metaphysical) effects. It employs military-grade millimeter microwaves in a civilian setting, technology which is already being used for nefarious ends.
It can be used to influence individual or mass behaviour. Mind Kontrol.
It can be used as a lethal and non-lethal EMF weapon to harass, injure or kill targeted individuals and populations.
It can be used to trigger specific disease and medical conditions via payloaded nanotech within the body, of which we are already chock full, and which the vaxx will only enrich.
It can be used to trigger specific and permanent DNA alterations.
It can be used to send instructions to synthetic organisms within the body.
Gates, who has patents on several components of the CONVID-1984 vaccine program, ID & tracking systems, etc, is invested in developing various nanotech delivery technologies using vaccines, not least with teams at MIT. (See the Corbett Report on YT for a good overview of Gates in a 4-part mini-series.)
5G, basically, is the ultimate control system. Combined with nanotech and AI, it is a formidable and scalable control system, from the mass, to the individual, to the cell, to the molecule and atom. This tech-mesh is a pandora’s box of evil.
Peace.
https://educate-yourself.org/cn/5G-A-Toxic-Assault-on-the-Planetary-Web-of-Life-31jan19.shtml
The 5G Trojan Horse, by Derrick Broze
https://www.youtube.com/watch?v=KfWAjDJvoaI (this keeps getting taken down)
Grab a fresh pair of shorts for this one
https://www.bitchute.com/video/Hay3FYxce9yv/
P.S.
I forget names and titles here but a doctor or scientist/engineer wrote a book recently suggesting the Spanish “flu” and other historic “outbreaks” were a consequence of major wireless rollouts across the world at the time, perhaps radio, TV and other. Apparently, a closer look at previous “pandemics” also reveals rank deception and manipulation, just like ours.
Yes, fascinating, thought provoking and educational read: https://www.thinkoutsidethebeast.com/wp-content/uploads/2020/05/Flu-Facts-RF-and-Viruses.pdf
Lovey link. Thank you.
I have also heard many things about the 5G theory, and think its very possible but something doesnt make sense to me. If 5G needs short distances to work effectively and constructing towers every few hundred feet, how can Elon Musk transmit 5G from satellites hundreds of miles away???
Someone is paying attention. I’ve had the same question for a while. Will research and post here if I find an answer.
This explains the ground stations https://childrenshealthdefense.org/news/what-you-should-know-about-5g-satellites-how-musks-sci-fi-dreams-are-becoming-our-living-nightmare/
Thanks.
It seems the satellites are the backbone network, and the ground stations are the “last mile” connectivity to the end customer. In this case, the satellite-to-ground-station link would not be 5G, but some other very high bandwidth network similar to the performance of fiber optics.
The 5G protocol would only be from the ground station to the user/device, or from ground stations to the 5G antennas in our neighborhoods (this link may not be 5G), and then from the antennas to the user/device (this link of course has to be 5G).
It is fairly obvious that the ‘story’ of 5G only working over short distances is complete misdirection.
If you go and check a map of 5G deployments (yes, they call them deployments) like this https://www.speedtest.net/ookla-5g-map you can see where the deployments are.
Now go and check service all the providers 5G coverage maps. There is a mass of coverage. There are not, at this point, transmitters along every street.
They haven’t put all those satellites up there just for show. They can hit you with 60GHz from low earth orbit. And they will.
The ‘story’ of 5G only working over short distances is complete misdirection.
See my response to Leigh above. Maybe an expert can confirm this.
Deployment is actually a common term for IT and telecom systems rollouts. Taken from military jargon perhaps, but this is standard industry terminology.
Thanks. My post was just to point out that this situation seems to exist where we are told that 5G is a remarkable technology… but actually rubbish. Its complete nonsense.
60GHz (probably pulsed) is the frequency that does the damage and they have had a LONG time to work on it, just watch the first 3 minutes of this…
https://youtu.be/kJ8eYZIwVHg
What it can do…
https://youtu.be/5oYt06JFiKA
https://ourgreaterdestiny.org/2020/02/5g-60-ghz-oxygen-absorption-you-and-coronavirus/
They may try pulsing high-band 5G (24-60GHz) and blame it on deadly Covid-20 variants. Those outdoors will be vulnerable. By then their scam will be out in the open, if you’ll forgive the pun.
He is getting approval for millions of ground stations, it may already be approved. https://childrenshealthdefense.org/news/what-you-should-know-about-5g-satellites-how-musks-sci-fi-dreams-are-becoming-our-living-nightmare/
Terrestrial energies need to be high to penetrate buildings. Satellite energy is low but only accessible from outdoor antennae. Both need appropriate shielding for safety.
Well, for one, you’re comparing towers with satellites and two…”hundreds of miles away” huh? Just how high up do you think it is to be in outer space? It’s only roughly 62 miles…again, satellites can send a signal across space to other galaxies and receive signals from just as far. Towers operate in an entirely different fashion and send signals out much like a bomb explodes…in all directions. Satellites can send signals and generally do in a more controlled straight line…think flashlight beam aimed upwards in the night sky…most of us did that as kids.
Dr Tom Cowan and his book The Contagion Myth. He has a great youtube channel.
His book references writings from Arthur Firstenbergs book The Invisible Rainbow.
Firstenbergs site: https://www.cellphonetaskforce.org/
Cheers. I’ve been following Dr Cowan for some months now, ever since he exposed that Covid-19 does not meet any of the 4 Koch’s postulates to prove that a microbe exists, causes a disease, and is contagious.
Dr Cowan is correct on non-existent viruses (=exosomes) but don’t get carried away … Chlamydia and Malaria are transmissible and very real!
They are caused by parasites.
More on 5G: https://www.westonaprice.org/health-topics/is-coronavirus-contagious/
Thank you.
Arthur Firstenberg “The Invisible Rainbow”
Humanity has been manipulated and fear controlled for centuries the truth is we have been lied to about everything.
Invisible Rainbow by Arthur Firstenberg
This article is excellent – I do not find any flaw in it but admit I am not a virologist. Anyway, one fact What we have to live with is: people are dying of an acute respiratory syndrome we are not knowing then caused by what. I agree there is no evidence it is by SARS Cov2 if that entity exists at all. But then, these deaths are caused by what? Might be worth an investigation, don’t you agree?
What strucks me is the efficacy of drugs like Hydroxychloroquine (HCQ) and Ivermectin – both are anti parasite drugs! Under early Ivermectin application almost noone dies anymore of this acute respiratory syndrome, regardless of his age! And under early HCQ combined with Zinc and Azithromycin neither!
There are now inumerous studies showing this – administered in the correct way, the rate of hospitalisation reduces drastically by about 80% and, of those hospitalized nevertheless, 50% less die.
Both drugs known for anti-parasite action – just to repeat!
Draw your conclusions!
Sidenote: never has been developed a vacine for Malaria our worm diseases!
The whole issue of people dying from ARS is solved by administration of either the HCQ or the Ivermectin protocol. No need for vacine, neither for masks nor lockdowns.
Whenever there’s an outbreak of illness and an uptick in hospitalization visits, the CDC (U.S. Centers for Disease Control) sends out two teams: toxicology teams and infectious disease teams.
Why weren’t the toxicology teams sent out? Notice how the U.S. government assumed that a *pathogen* was causing the alleged outbreak of illness supposedly “spreading” around the planet.
The toxicity issue was ignored.
If you check out the Med Scape interview with Dr. Cameron Kyle Sidell, you’ll notice that he refers to the respiratory illness as not pneumonia, but something resembling an altitude-type sickness. He’s almost about to point out that it’s NOT caused by any pathogen, but realizes that doing so would turn the medical board against him.
The illness that Dr. Cameron Kyle Sidell described is characteristic of electromagnetic hypersensitivity (EHS). In many places, it’s largely due to the 5G rollout. Wuhan was actually a PILOT city for 5G technology. In addition to that, incinerator plants and excessive pollution had already begun causing problems in people long before December of 2019.
Check out the summer 2019 Wuhan protests regarding two incinerator plants. I won’t go into why germ theory is fallacious here, but do know that toxicity can cause disease, and this is even acknowledged by mainstream allopaths and WHO officials.
If it’s related to 5G then why is it that low income populations are most affected?
The attribution of deaths and illnesses to COVID is a bit more complicated than that. While EHS (electromagnetic hypersensitive) individuals are certainly being labeled “COVID” patients, many patients with other health problems are also being classified as “COVID.”
Here in California, for example, hospitals are seeing more patients NOT just because of aggravated health conditions resulting from postponing elective procedures, but ALSO because of months-long exposure to wildfire smoke. This combined with excessive mask-wearing and the consequences of sheltering in place is leading to hospital overcrowding in some areas.
With regards to why lower-income populations are more affected, it could be because most do not receive sufficient nutrients and often work jobs where exposure to toxins is common. It could also be due to the adverse effects of prolonged mask-wearing…something which CAN induce respiratory problems due to the lack of oxygen saturation.
It’s really a game that involves fear-mongering, government tyranny, the advantages of a globalist, technocratic society, and the ignorance of the masses.
Can you explain more? In our country, there is not any 5G technology but why we have also many Covid-19 patients?
What’s occurring in many parts of the world is that almost all deaths and hospital visits are being classified as “COVID-19” to help further the globalist agenda.
I’m unsure about which specific country you’re based in, but do know that even 2G, 3G, and 4G can induce respiratory problems and various other health issues in individuals who are hypersensitive to non-native electromagnetic fields.
Always remember that ALL disease is the result of two things: deficiency or toxicity. A deficiency can be something like a nutrient imbalance, lack of sleep, lack of exercise, etc. etc. Toxicity, on the other hand, refers to the poisoning of the body. It can be the result of higher frequencies of electromagnetic radiation, incinerator emissions, pollution, commercial agricultural chemicals, fertilizers, herbicides, pesticides, cleaning products, etc. etc.
Also keep in mind that in many areas purporting to experience hospital overcrowding, #FilmYourHospital footage has proven these claims to be either unfounded or largely exaggerated. Even IF hospitals in your area are overcrowded, they are likely so due to what I stated above and the following:
1) Postponement of elective procedures. When the lockdowns began in March, many individuals with pre-existing health problems postponed certain procedures out of fear or because hospitals only desired to admit “COVID” patients as a result of the doomsday predictions.
As you may imagine, when you postpone elective procedures, your health condition(s) or problem(s) worsen, especially when you factor in constant media fear-mongering and the consequences of the lockdowns.
2) The consequences of the lockdowns: Aside from the above, many are bombarded with constant media fear-mongering, feelings of worry about not being able to open their business back up, anger and resentment at having their civil liberties taken away, etc. etc.
3) Excessive mask-wearing: Masks reduce oxygen saturation, increase cortisol levels, and result in the body’s T-lymphocyte production going down, which all make us more susceptible to disease.
Many doctors have described patients who have suffered respiratory problems as a DIRECT result of prolonged mask-wearing. There is no scientific basis for masks; administrative divisions around the world are requiring them either out of sheer ignorance or because they’re complicit.
In addition to what I stated, there was also the incorrect usage of ventilators which I forgot to mention.
Patients labeled “COVID” need MORE oxygen; they don’t need trouble breathing. That’s why doctors such as Dr. Cameron Kyle Sidell implicitly suggested that current protocols (in reference to intubation procedures) should be reconsidered.
5G is actually powerful enough to disrupt the Earth’s magnetic field because the radiation can be circularly polarized by interaction with atmospheric dust and therefore may penetrate deeper into people than previously thought. 5G can also interfere with frequencies of other non-native electromagnetic fields, resulting in hot spots of “dirty electricity” (aka electrosmog) which can VERY toxic to certain people.
Iran, as an example, deployed 5G. The radiation was powerful enough to affect even the Indian subcontinent. Allopathic medicine often ignores the electric nature of human beings and animals, hence why these things aren’t taught in mainstream med schools.
Don’t consume mainstream media!
Excellent article. And I believe you are right, Dr Rosner. In any case, the risk of dying from ‘Covid-19’ (0.01%) is no greater than risk of dying of ‘flu’ or of painful illness from vaccines made by bio-warfare scientists using ingredients that should alert the regulators if they were not being frog-marched into hasty ‘certification’.
I disagree that there is a new, specific acute respiratory syndrome that is killing people. The vast majority of deaths of so-called COVID deaths take place in nursing homes amongst the very elderly. Average age 82! It’s what happens when you get very old: Your lungs disintegrate, like every other organ. Elsewhere, respiratory diseases are caused by pollution and other local environmental circumstances. Just like HIV/AIDS, where the WHO decided to create a new disease out of already-existing ones and include them under the same umbrella, the same is being done with COVID: Various respiratory illnesses that have been around for a long time are being rebranded as a new disease – all to facilitate the greed of the pharmaceutical industry.
Hydroxychloroquine a Proven Effective EARLY Treatment for COVID-19
HCQ (Hydroxychloroquine) was developed as a pharmaceutical drug intended to replace the effective tree bark obtained Quinine, as a treatment for Malaria. HCQ is a Proven 55 years, billions of doses, SAFE, very effective, PREVENTATIVE and Treatment for COVID-19. Search for “Hydroxychloroquine as COVID-19 Prevention and EARLY Treatment”
Why would the Health Care Establishment BAN a treatment that works.
HCQ is next to being functionally banned in the USA. Why would the Health Care Establishment BAN a treatment that works. Why would they conduct bogus “testing” to falsely show HCQ to be harmful? Because that is one of the PLANS in this Plandemic. They want the ONLY answer to COVID-19 to be a killing fields Bill “kill em” Gates “vaccination”
http://healthyprotocols.com/image_hcq%20_case%20mortalitybycountry.png
‘Virology’ is a non-profession, conjured out of thin air!
“But then, these deaths are caused by what?” Maybe different people in different places have respiratory problems for different reasons? Maybe we need to look at each patient’s environment and health history individually? I know it’s a crazy thought, but does it make any sense to blame everyone’s death on the same thing?
Hallo my chums
Still hope ? burning ..in that belly ? .
still bending? like twig ? When is it going to break ?
IT will be all right in the end? wont it ?
Sure?
when is enough enough ?
https://www.facebook.com/332813307184805/posts/1033122780487184/?sfnsn=scwspwa
PREPARE!
don’t waste energy and surely not money to jump through their hoops.
This vid is really sad but ? what the F^%$k people ? what are you expecting
THIS has never been about YOUR Health !
Wake the F@&$ UP!
Brilliant. Did you know there are also at least 3 published papers from 2007 and 2008 that discuss a SARS-COV2 virus… one as eg in weblink
link?
Should the article read the WHO declared the pandemic in March 2020 rather than March 2019? An otherwise great article, but if this is an error it would be valuable to correct it. Thank you.
Mare, I researched the date. The WHO did in fact warn of the inevitable “pandemic” in a publication in March on the 11th in 2019.. http://www.who.int/news/item/11-03-2019-who-launches-new-global-influenza-strategy
Agree https://flaneuring.medium.com/is-the-uk-government-acting-like-a-criminal-a8f3151fe27e
Soviet Union leaders knew all the years about the criminal character and structure of Capitalism, and were trying to protect its people from western civilisation poisoning. But in the end could not resist the pressure from the West and the pressure from within. Today Russia is “enjoying” capitalism in all its ugliness and much more.
Bill Gates is the Father and the Mother of this global scam/fraud. HIS vision of the “better” world is to reduce population by billion. Mostly by eliminating those aged 60 plus and all others with health conditions. HOW? with vaccination. Not necessary forcible. Enough to convince the public/sheep that vaccine is good for you, then it’s on automatic.
BUT….the BELLS of trouble are beginning to ring. Yesterday PFIZER announce about 2 deaths from their vaccine. I think Pfizer is beginning to realise that they and all other vaccine producers are committing fraud, and therefore in order to protect themselves in a possible future mass trials, they activated the first bell.
You are on the right track, but 2 suggestions for you to research.
1) Bill Gates is not the father and mother of this killer agenda. He is just the manager. He has much more powerful bosses in the shadows. He takes direction from the global central banking cartel (the Rothschild & Rockefeller criminal gang that owns the Federal Reserve and other central banks, including the central bank of Russia.) They create the global money supply through private institutions.
2) Communism was conceived and brought to Russia & China by THE SAME capitalist gang in London and New York. Read the true history of the Bolshevik revolution. The funding and directions came from NYC. Schiff & Warburg bank-rolled it. And Leon Trotsky was from Brooklyn. His real name was Lev Bronstein. It is a theater they play, like good cop bad cop, but on a global scale. They use conflicts, both of which sides they control, to drive history forward through dialectical friction.
This phony conflict is seen in the Left vs Right drama, World vs. Terror theatrical production, and now the World vs. Virus summer blockbuster. Yes, ISIS & al-qaeda are both funded and managed by US, UK, I… s)raeli…** and Saudi intelligence agencies.
It’s a big movie, kid… a stage production. Willy S. was right.
It is a time of great deception and you have to pull back many layers to get to the truth.
Peace.
Wonderful article! Just wished all would come out months earlier and prevented the unnecessary deaths and livelihoods loses. I run also lot of the BLAST searches, in particular patented proteins from old the ‘other’ vaccinations. We have to assume that the official SARS-CoV-2 genome is just theoretical, BUT RIGHT NOW it is becoming ‘practical’ in the sense that that’s theoretical genome is the foundation of all the contents in all the new SARS-Cov-2 vaccines!!!! People are dying already because of that. That needs to be STOPPED A.S.A.P.
It’s all lies, all the time.
The Patented Bioweapon Injections are multifaceted killing machines. THIS IS Phase 3 of the Pharma Testing of these weapons. Many mixed batches being used…and with zero quality control. They are full of Graphene Oxide and other toxic materials. In fact the injections come with a plethora of Construction materials. All manner of metals and glass and etc…. These materials verified by scientific testing…such as Raman Spectroscopy. The NGO is a natural body temperature Super Conductor. Human Bodies are electromagnetically operated…we are electrical…there’s also a light component. Even the Chemicals in our bodies depend upon their electrical charges… properties for full functionality. When deployed in the body, graphene oxide immediately super conducts the energies of the body via it’s material and emits an electromagnetic field. It is also programmed from every available EMF, such as WiFi and/or Cellular systems… with instructions to construct nano solid state components with antennae and many other esoteric devices all networked with what appears to be Fiber Optics emitting light. There are interface control documents; technical papers online that describe the particular interfaces that are built to enable the components to get information from within all of the biological components of the physical body and then interface and transmit that data into the 5g system and then on into the Cloud…A.I. Further…this system is fully capable of 2 way communications/data transmission…capable of controlling a physical body via a Delusion, an artificially created reality.
La Quinta Columna, a Scientific Research Team from Spain have discovered The nanite activity within the blood and cells… and published quite a number of videos of these phenomena since almost the beginning of the Hoax c19 Terror Pandemic Campaign. These have all being since verified and replicated via the scientific method by a number of other research teams around the globe. Check out their website. Their reports are subtitled with English.
ZER IZ NO COVID-19.
Watch Dr Andy Kaufman and Dr Tom Cowan. Or Max Igan and David Icke (yes, I said it–David Icke.) My laundry list of fraud giveaways, a lot of overlap with what has already been said. Just copying and pasting from other comments sections I’ve posted this to:
Dr Kaufman demonstrates that a new virus has not been isolated and purified from patient samples.
Dr Cowan demonstrates that not one of Koch’s 4 postulates have been met (the 4-step method for proving that (1) a microbe exists, and (2) causes a disease, and (3) is communicable.)
The RT-PCR test endorsed by the WHO and being used worldwide does not test for an isolated virus. The inventor Kary Mullis said explicitly that his test is useless for diagnosing infectious disease.
The test sensitivity can be amplified–turned up and down like volume–to increase or decrease “positive” cases as they see fit, to simulate, for example, lower case numbers due to the efficacy of the “amazing,” “warp speed,” “experimental,” mRNA vaxxine.
TESTING POSITIVE MEANS NOTHING.
People who haven’t even taken the test are receiving results in the mail that they are positive.
If you test positive and get hit by a bus and die, the death certificate will say Covid.
The CDC has admitted that it does not have any viral fragments for the so-called Covid-19 virus.
A Freedom of Information (FOI) request to the national health service in Ireland to provide proof of a new virus has been met with a response that they do not know of any virus that has been isolated and identified.
Flu cases went to 0 in Queensland, Australia and elsewhere these past season. The regular flu is being designated as Covid.
There is NO excess mortality worldwide compared to previous 2-3 years statistics (death from all causes stat.)
The CDC is pressuring doctors to put Covid-19 on death certificates, and allowing doctors to determine a Covid cause of death without scientific/medical proof.
US hospitals receive $13,000 for every patient admitted as Covid.
$39,000 if the patient is put on a ventilator, which is proven to accelerate the death of people with “Covid” symptoms.
Masks stop viruses like goal nets stop mosquitos.
Zer iz NO NEW VIRUS. NO NEW DISEASE. It is A BLATANT SCAM. Don’t play along with “Covid”. More like Convid.
It is about the World Economic Forum’s GREAT RESET and UN Agenda 2030.
A global totalitarian coup.
The coming VAXX will add nanotech into the body (which has already been flooded with nanoparticles in the last 20 years) and merge man with AI, using 5G.
It will also have other biotech which permanently alters our DNA, in addition to the usual heavy metals, bacteria, infertility agents and human & animal fetal tissue that they already put in vaxxines. Our rulers are eugenicists and they think there are too many of us breathing.
Wuhan was the first city in China to launch 5G, right before the “outbreak.”
5G operating at 60 GHz deprives the body of oxygen–a common “Covid” symptom.
Most countries where 5G is now live launched their services during H2 2019 and H1 2020, perfectly coincident with “Covid.”
It is the BEAST takeover folks.
If you shine an empirical light on this plandemic, you will find it to be a hoax like everything else they push out.
Peace.
2 questions then
What about the people experiencieng lost of smell and taste?
And what is in the vaccine then?
Air pollution? Chemtrails?
To make people sick and feed them to the Medical machine.
According to the overall flu death rates in all the previous years, I saw just recently, an increased death rates were happening since ~2017. That’s the time where loss of taste and smell started to accompany many flu-like symptoms. In old people it might take even a year to get it back, in young people much less.
The vaccines contain that ‘theoretical’ NIH stored SARS-CoV-2 genome with contents which I do not even want to mention, not to scare people. 2 volunteers in the test group in Pfizer trials died, but they died NOT with the covid-19 symptoms though, which implicates what’s in these vaccines is something totally different than the official flu-like disease called covid-19.
Definitely 5G needs to come into play when talking about SARS-CoV-2.
The loss of taste and smell is rare but not unheard of in flu cases. For sure not all covid19 cases involve this either. Zinc deficiency and cyanide poisoning can cause these I think. Hydrogen cyanide is released during the refining of fracked oil. How much is released depends on how it’s regulated and how well the regulations are enforced/followed. The environmentalist Jim West argues that this explains much of the covid19 labeled medical phenomena.
i have always lost taste and smell with a common cold…… come on nothing new here…
Thanks for that Sebastien: I was scanning through the comments to see if anyone had mentioned Jim West. I’ve recommended his books to everyone on my list. His dangers of pre-natal ultrasound work is critical and his book on DDT having been the cause of Polio is a must see for anyone trying to figure out how the establishment can get things so wrong. His hypothesis on Hydrogen Cyanide is so persuasive I’m getting a meter just to experiment in my travels. Anyone near a refinery or a power plant should be concerned and YouTube has many documentaries of poor neighborhoods in legal battles with the Valero’s, Marathon’s, and others in the industry. Even people just living near the fracking operations themselves get mysteriously sick and some have abandoned their homes after exhausting health and financial resources trying to fight the battles. Jim’s work is over at Harvoa-med.blogspot dot com
Forgot to mention the Virus Mania book published in 2007. Well worth a read for historical insights on the use of unproven viruses as ‘medical-covers’ for industrial poisonings. With a very extensive bibliography, this book must have taken a very long time to assemble. Jim West is quoted in a number of sections.
This is an interesting article reviewing the loss of the senses during sinus infection, common colds (coronaviruses) and covid 19.
https://www.healthline.com/health/coronavirus-loss-of-taste-loss-of-smell#test-your-senses
It would be interesting to study if there is a correlation with prolonged mask use and minor bacterial infections of the sinuses. If so, could this explain the loss of the senses being the only symptom for some noticed during this “pandemic”.
Unfortunately, the vaccine ingredients have not been disclosed as far as I know. But some facts includes: no developer, distributor, or administer of the vaccine can be held liable for proven damages done to any recipient. Scary. It has not been held to the same rigors of any previous vaccine in the vetting process. The animal trials are humans themselves. Finally it is stated that it is a synthetic mRNA vaccine that requires extreme and specific storage requirements.
Most importantly, with this information, would you voluntarily take a vaccine that at the very least, with genetic code, instructs your cells behavior (especially after reading this article), only to hopefully learn what ingredients have been injected in to your body after receiving said vaccine? And if you have any side effects, well you are responsible for those.
What is the vaccine? Could we trust them if they told us? Perhaps nothing much. What’s the end game? Immunity passports. Everyone for ever and a day could test negative, but you’re still in the same boat. Was anyone ever caught with exploding underpants and shoes at airporto check-ins?
Loss of smell and taste – Zinc deficiency. https://www.medicalnewstoday.com/articles/320393. Why [they] have pulled/stopped producing zinc supplements, lozenges, etc.
And maybe when they kept the liquor stores open throughout the lockdowns. (Chronic drinking causes zinc deficiency.). And perhaps why they severely dismissed Vitamins C, D and Zinc supplements as “effective”. D is essential to T-cell production and T-cells are a measurement of a healthy immune system. So perhaps supplementing would be counter to what they were trying to create happen?
FYI I just ordered Zinc so it has not been pulled from the www. Not yet anyway…
Definitely still available, as of late January 2021.
Zinc deficiency as they scare people – especially old people – from eating oysters because of “cholesterol”, which is another scam.
You may not have noticed if you have a blocked nose and fever that you also have no sense of smell or test. People seem to forget having these symptoms with the flu because of hearing that’s happened with coronavirus. Maybe you never had real flu, when you also have no appetite to eat because of no test.
This is what i have discovered after suffering since March of this year. Proof is all the people that have been suffering. This flu virus has been engineered.
Please review my evidence on https://c19truth.wordpress.com
I certainly agree than emf is probably causing you problems. I would suggest grounding such as bare foot and get special grounded shoes or work out how to modify some with a wire or something. I am not sure shielding is the way to go as there is natural frequencies that are healthy. Probably a environment with lots of trees away from the city is advisable and onviously get rid of all wifi and cell phones. Get sunshine. 15 minutes a day full body atleast on average. As far as the virus I think you just reached as stage where it is worse and the keto stuff is part of the conspiracy. I’d suggest fruit and salads and to check out Cyrus Khambatta and Robby Barbaro—co-founders of Mastering Diabetes. In the vegan world there is a lot of attacks on fruit originating from the usual suspects with promotion of protein such as beans. I think the protein is damaging the kidneys. maybe pine nuts is ok but look into food combining. You can look for example at this video from freelee who I think is a good source showing an example of these attacks on fruit in vegan youtube which have all sorts of arguments that are given that seem to be deceptive and not the true reason for the objections to fruit.
This guy mic the vegan has a video promoting ‘masks’ by the way. It has quite a lot of dead links in the summary. freelee on the other hand has videos exposing the covid such as “4 months of freedom left? Why you must leave the city now”.
if you try touching a metal cold water pipe it probably goes to ground and see how it feels.
I will try this, then for my folks. Good tip, thank you.
May I ask you, have you tried this? To what effect?
I highly recommend the company Blushield for EMF protection. I found them through Ben Greenfield(very well known and trusted).
These scientists have issues with the PCR test.
External peer review of the RTPCR test to detect SARS-CoV-2 reveals 10 major scientific flaws at the molecular and methodological level: consequences for false positive results.
https://cormandrostenreview.com/report/
Former Pfizer VP said No vaccine needed
https://www.lifesitenews.com/mobile/news/former-pfizer-vp-no-need-for-vaccines-the-pandemic-is-effectively-over?utm_source=LifeSiteNews.com&__twitter_impression=true
REPLY
Hello, Great article, I have a question though, People who push these allegations insist that your article is a conspiracy theory nonsense, Even though when I point them the official sources, they fanatically defend that SARS-COV-2 was isolated and there are numerous citations and examples,
one particular example I get is:
“Identification of Coronavirus Isolated from a Patient in Korea with COVID-19” https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7045880/
When infant the article claims: “The virus replicated in Vero cells and cytopathic effects were observed. Full genome sequencing showed that the virus genome exhibited sequence homology of more than 99.9% with SARS-CoV-2 which was isolated from patients from other countries, for instance China. Sequence homology of SARS-CoV-2 with SARS-CoV, and MERS-CoV was 77.5% and 50%, respectively.”
Here is the catch I might be wrong though so correct me If my assumption are baseless they base their 99.9% sequence homology SARS-CoV-2 claim on previous isolation of the virus and assume that the virus was isolated before so what ever they have found must be the same alleged virus, which they claim it accurately resembles that, and then go on and mention that the alleged virus has sequence homology with SARS-CoV, and MERS-CoV was 77.5% and 50%, respectively.
So If I understand correct:
1. This entirety of this article is baseless because it assumes that there is a virus and that assumed sequence homology is used in their study.
2. It admits that the alleged virus has some resemblance to SARS-COV and MERS-COV.
Hi ilgar
The paper you quote is somewhat misleading as it is about a ‘ viral isolate ‘ obtained from patients . It doesn’t concern or refer to pure isolated virus particles that were isolated from samples using density gradient ultrafiltration. What they did find in their isolate was bits of genetic material RNA which they inoculated and cultured in chemically treated Vero cells to use in PCR tests.
They were also using a ‘viral model’ which they concocted in their database for the probes and primers which were never claimed by any scientist to be based on any original SARS -Cov-2 virus that had been been previously isolated by the method I have briefly described above. Similarity or resemblance is problematic -the map is not the territory – it is not an identity. So, in a nutshell, the paper is a deception. See also my other posts which may also help clarify a few issues concerning virus isolation etc.
PANDEMIC it’s SET TO.
SAVE THE YOUNGER GENERATION THEY ARE THE FUTURE.
YOU DONT SHUT SHOP TO PRESERVE THE MOULDY DOUGH YOU SHUT SHOP TO PRESERVE THE WHEAT THAT MAKES THE FLOUR TO MAKE THE BREAD
Capitalists don’t shut down whole economies to save 80 year olds. I knew that in March. Why has it taken people so long? It was self-evident. This action was never done in history, quarantining the healthy. Ridiculous!
That wouldn’t settle the issue whereas presenting a scientific paper with full details as to precisely how the alleged SARS-Cov-2 virus was effectively isolated at a specific density gradient as pure virus particles and nothing else that would be a start.
Without the purified virus particles that have also been proven to be infectious, any primers and probes used in PCR would be meaningless since they are ultimately derived from the density gradient banded material containing pure virus particles and nothing else.
Who the fuck are you replying to?
You!
Any response to Daniel below?
Interesting take on it. So all the sick and those who have died is caused by what? They were happening prior to lockdowns. I am afraid albeit an interesting argument you have used the same fragments to disprove the existance just as you have accused those of creating it.
Look for a paper in Research Gate from Denis Rancourt that says: “No plague and evidence of mass homicide” (something like that) that article will answer your question
Great article, but what happens next? What needs to be done to get back to how everything was and hold the people who has pushed this accountable?
Join the Common Law Court so that justice can be obtained for We the people against those who are perpetrating the fraud that SARS-Cov-2 has been isolated as pure infectious particles free from any contaminants AND is the sole cause of Covid -19 as claimed.
I can only repeat that no known scientists have been able to conclusively prove that claim to date, despite the numerous papers that are now abundantly available on the alleged virus and Covid -19.
This is a nonsense article full of misdirection and false equivalences.
I was thinking about going through to debunk each of the author’s points, but the more I read the more disheartened I got. He has gone through great lengths to mislead and ignore evidence contrary to his claims. This appears to be skillfully constructed misinformation, although I can’t say I understand what his goal is.
I am in fact an expert in genetics, in the last year of my PhD in epidemiology and bioinformatics.
Here are some highlights of blatant and seemingly willful ignorance. I’d be happy to talk about these more or discuss any of his other arguments that appear convincing if you are interested.
Iain Davis, if you do stand to be corrected as you claim, please address these points and I would be more than willing to take a second look. But as it stands, your articles is riddled with false conclusions and misinterpretations that cast doubt on your motivations and findings.
Since SARS-CoV-2 has been isolated, characterized, and thoroughly studied by all current standards in the biomedical research community, the burden of proof is on you if you claim that SARS-CoV-2 does not exist. This article fails far short of that burden.
Taken from the article you quote, published by the CDC
https://wwwnc.cdc.gov/eid/article/26/6/20-0516_article
“Because research has been initiated to study and respond to SARS-CoV-2, information about cell lines and types susceptible to infection is needed. Therefore, we examined the capacity of SARS-CoV-2 to infect and replicate in several common primate and human cell lines, including human adenocarcinoma cells (A549), human liver cells (HUH7.0), and human embryonic kidney cells (HEK-293T), in addition to Vero E6 and Vero CCL81 cells. We also examined an available big brown bat kidney cell line (EFK3B) for SARS-CoV-2 replication capacity. Each cell line was inoculated at high multiplicity of infection and examined 24 h postinfection (Figure 3, panel A). No CPE was observed in any of the cell lines except in Vero cells, which grew to >107 PFU at 24 h postinfection. In contrast, HUH7.0 and 293T cells showed only modest viral replication, and A549 cells were incompatible with SARS-CoV-2 infection. These results are consistent with previous susceptibility findings for SARS-CoV and suggest other common culture systems, including MDCK, HeLa, HEP-2, MRC-5 cells, and embryonated eggs, are unlikely to support SARS-CoV-2 replication (20–22). In addition, SARS-CoV-2 did not replicate in bat EFK3B cells, which are susceptible to MERS-CoV. Together, the results indicate that SARS-CoV-2 maintains a similar profile to SARS-CoV in terms of susceptible cell lines.”
What does this mean?
Sars-cov2 cannot infect humans?
About scientific magazines.
Do you know Lancet? Do you know Nature?
Is this letter published by Lancet scientific and what is the basis cited in thousands of articles to support the zoonotic origin of the virus?
https://www.thelancet.com/journals/lancet/article/PIIS0140-6736(20)30418-9/fulltext#%20
Have you read how this letter and its subsequent one in Nature were drawn up?
Check this please
https://usrtk.org/biohazards-blog/ecohealth-alliance-orchestrated-key-scientists- statement-on-natural-origin-of-sars-cov-2
Is this procedure scientific?
Do you know that Peter Daszak, the maker of the famous letter, is president of the Ecohealth Alliance, (look a bit at his connections with the Wuahn laboratory) he is the president of the Lancet and WHO commission to elucidate the origin of sars-cov2 ? What can we expect from both commissions?
Do you know the story of the Lancet and hydroxychloroquine?
If you don’t know, I’ll explain it to you.
According to this, Is Lancet more credible than Dsalud?
Reply to Alex
The whole thing is a con anyway Alex. Why? Because according to virology pathogenic viruses can only replicate (if it can be proven that they actually do replicate at all) only in special host cells with special attributes namely host cells that are ‘suceptible, permissive, accessible and have defunct defences or initially nearly defunct.
The viruses in turn are also assumed to be endowed with special attributes that are appropriate to those of the host cells they allegedly infect such as being endowed with ‘pathogenicity ‘ and the appropriate receptors. Both the special host cells and the viruses exist as unconditional functional postulates and the relationship between them is also universal and inexplicable. Wherever there are pathogenic viruses there must also be these special host cells for them to infect!
Thus, the special host cells must exist in order to perform all the necessary functions that are appropriate for the virus to replicate and the virus must exist in order to replicate in the appropriate host cells in order to survive. The closed and empty circle of functional determination – or simply put the revolving door!
Hi -CO
Where is the response to Daniels post, comments and questions?
In this thread so to speak…
As posted on Nov 27, 2020 3:37 AM (according to my computer).
Kind regards Jesper
Jesper consult this article please:
https://www.dsalud.com/reportaje/el-supuesto-sars-cov-2-es-un-constructo-incapaz-de-infectar-y-no-un-coronavirus/
Hi Jesper
The main reason why I have not responded to Daniels comments and questions is because they all presuppose that SARS-Cov-2 has been successfully isolated free from all contaminants, photographed and it’s genetic material and proteins successfully sequenced and biochemically determined.
This is Not the case and some of the issues that Daniel raises may be valid if and only if proof that SARS-Cov-2 can be produced with full scientific, technical and methodological procedures used to obtain the pure virus particles. Otherwise all other debates concerning the whys and wherefores of this alleged virus are entirely academic and a complete waste of time.
So I’ll say it again:
CONCRETE SCIENTIFIC PROOF OF THE PHYSICAL EXISTENCE OF THIS ALLEGED VIRUS IS THEREFORE REQUIRED TO BE PRODUCED BY THOSE CLAIMING THAT IT EXISTS BEFORE ANYTHING ELSE SO FAR IT’S EXISTENCE HAS ONLY BEEN POSTULATED AND REMAINS AS AN ABSTRACT SPECULATIVE MODEL.
Regards -CO
https://youtu.be/8bX-wFVBP94
Hi Daniel.
Have you looked at these comments :
https://cormandrostenreview.com/report/
Thank you. Someone who’s gone to great lengths to expose this idiot. I’ve lost a few friends and many relatives to covid-19 and I believe that we have much more trouble ahead if people start believing crap like this. Sad.
If I were one of those deceased friends or relatives, I would not forgive you, for being accomplice to those who falsify the cause of, if not actually iatrogenically causing, my death.
Decent enough effort Daniel, when compared to trolls and incapable officials of main stream narrative. But you tend to generalize too much with a preoccupied full denial attitude.
You have not made any comments about the primers , etc on the Spanish article. Their work seems valid there. Use of open databases result of a 100 similar cases when primers should be unique and part of supposed viral dna. Those are basics when one constructs a PCR test. Furthermore, their work on issue, seems to be supported by a science team who recently objected the Drosden paper, the one started all panic with fake tests.
Furthermore, there is a problem with biotech and this bring the pure scientific applicability to its knees. It has a speculative element to it. LACK OF REPRODUCIBILITY.
https://onlinelibrary.wiley.com/doi/epdf/10.1111/eci.12801
If the virus has been isolated, why are Astra Zeneca & Johnson & Johnson not using it. They are using adenovirus( common cold) as the basis for their vaccines. Pfizer & Moderna are not even using a virus but mRNA? Traditionally vaccines are produced from the pathogen causing the disease.
Daniel discredited Discovery Salud for its claim, among other things, about cholesterol not being harmful to health.
If cholesterol were harmful to health, you would be dead long ago, for it is in every single cell of your body.
It is absolutely ludicrous to claim that, ingesting a nutrient that is used in every cell in the body, in its natural form similar to how it is used in our bodies, can be harmful to health.
did you isolate it or did you just take the zionist’s word for it at the BBC?
covid is fake
Insofar as science is concerned if somebody makes the claim that a virus referred to as SARS-Cov-2 is the sole cause of Covid-19 the onus is on those who are making the claim to provide proof of claim.
So far this has never been done as no scientist has ever claimed to have produced concrete evidence obtained using the correct methods for virus isolation/purification. Moreover, no scientific proof or convincing evidence has been produced that the alleged virus is the cause of Covid-19 in human beings using the Henle-Koch Postulates as modified by T Rivers for viruses together with the necessary control experiments.
At the onset of a Covid19 the alleged virus would be present as complete particles in abundance and would be easy to isolate using standard density gradient ultra-centrifugation and filtration methods which are never used instead they resortto PCR which was never meant for virus detection so there is no way it can detect a complete SARS-Cov-2 virus even if one existed! So, there is a case for scientific fraud and deception by those who are advising the government and they should be held accountable in a common law Court convened by the people.
@-CO
Do you know these articles?
https://www.biorxiv.org/content/10.1101/2020.03.02.972927v1.full.pdf
https://www.biorxiv.org/content/10.1101/2020.12.14.422737v1.full.pdf
Yes Alex, the authors despite their claims, produce no evidence of pure isolated SARS-Cov-2 particles obtained by density gradient ultracentrifugation with any banding details ,electron photographs showing specific particle diameter and particles free from all other contaminants. In other words they did obtain “isolates” from samples but isolates are not pure virus particles, isolates only contain bits of genetic material that could come from anywhere along with other cell debris and contaminants.
thanks -CO, but other viruses do exist, for example: herpes.
There is no conclusive proof that viruses other than what they call phages exist. All other alleged pathogenic viruses are theoretical models originally based on phages and that goes for the alleged herpes virus too. I can’t find any evidence that demonstrates that the herpes virus exists by the methods I have previously described. If you can find such a scientific paper that demonstrates the fact in detail I’ll be more than happy to have a look at it.
Thanks again -CO,Can I ask you some questions about this?
The Herpes virus may exist, but it can’t be reliably located in patients with obvious herpes sores.
“No good screening test exists for herpes — a viral infection.”
https://www.mayoclinic.org/diseases-conditions/sexually-transmitted-diseases-stds/in-depth/std-testing/art-20046019
Very informative article, well researched and presented
The sheeple of this world will still refuse to beleive the truth
The politicians will claim they only followed the science to cover there backs and escape jail
People need to wake up to the lies and deceit they have been presented with
In Scotland during the first few months of lockdown the majority of calls to the police were neighbours grassing up there neighbours.
That is exactly what the powers that be wanted people turning on each other and creating a stazi
Re covering their backs. So true. The politician in charge of this scam in my neck of the woods is on the record many times saying he’s doing what the experts/his health officer is telling him to do. Which is code for our governments are not in charge. Which I suppose has always been the case, we’re just truly waking up to this now.
It is crazy
copy the below link and when it opens click on full images and scroll to page 9
on the right hand side of the page, be amazed with the line that says coronavirus is not known to cause severe illnes in humas
This is a US patent in 2003, share with as manyy people as possible
It will be up to the few like ourselves to save the sheeple.
censorship is rife on google / youtube / twofacebook etc
https://pdfpiw.uspto.gov/.piw?Docid=07220852&homeurl=http%3A%2F%2Fpatft.uspto.gov%2Fnetacgi%2Fnph-Parser%3FSect1%3DPTO2%2526Sect2%3DHITOFF%2526p%3D1%2526u%3D%25252Fnetahtml%25252FPTO%25252Fsearch-bool.html%2526r%3D6%2526f%3DG%2526l%3D50%2526co1%3DAND%2526d%3DPTXT%2526s1%3D7220852%2526OS%3D7220852%2526RS%3D7220852&PageNum=&Rtype=&SectionNum=&idkey=NONE&Input=View+first+page