Send in the Clowns for the Circus Is in Town

Edward Curtin

Don’t bother, they’re here, already performing in the center ring under the big top owned and operated by The Umbrella People.

Trump, Biden, Pence, Harris, and their clownish sidekicks, Pompeo, Michelle Obama, et al., are performing daily under the umbrella’s shadowy protection. For The Umbrella People run a three-ring circus, and although their clowns pop out of separate tiny cars and, acting like enemies, squirt each other with water hoses to the audience’s delight, raucous laughter, and serious attentiveness, they are all part of the same show, working for the same bosses.

Sadly, many people think this circus is the real world and that the clowns are not allied pimps serving the interests of their masters, but are real enemies.

The Umbrella People are the moguls who own the showtime studios – some call them the secret government, the deep-state, or the power elite. They run a protection racket, so I like to use a term that emphasizes their method of making sure the sunlight of truth never gets to those huddled under their umbrella.

They produce and direct the daily circus that is the American Spectacle, the movie that is meant to entertain and distract the audience from the side show that continues outside the big top, the place where millions of vulnerable people are abused and killed. And although the sideshow is the real main event, few pay attention since their eyes are fixed on the center ring were the spotlight directs their focus.

The French writer Guy Debord called this The Society of the Spectacle.

For many months now, all eyes have been directed to the Covid-19 propaganda show with Fauci and Gates, and their mainstream corporate media mouthpieces, striking thunderbolts in the storm to scare the unknowing audience into submission so the transformation of the Great Global Reset, led by the World Economic Forum and the International Monetary Fund, can proceed smoothly.

Now hearts are aflutter with excitement to see the war-loving Joe Biden boldly coming forth like Lazarus from the grave to announce his choice of a masked vice-presidential running mate who will echo his pronouncements.

And the star of the big top, the softly coiffured reality television emcee Trump, around whom the spectacle swirls, elicits outraged responses as he plays the part of the comical bad guy.

Punch and Judy indeed.

All the while the corporate mainstream media warn of grim viral milestones, election warnings, storms ahead! The world as you know it is coming to an end, they remind us daily.

The latter meme contains a hint of truth since not just the world as we know it may be coming to an end, but the world itself, including human life, as the clowns initiate a nuclear holocaust while everyone is being entertained.

Meanwhile, as the circus rolls along, far away and out of mind, shit happens:

With more than 400 military bases equipped with nuclear weapons surrounding China, the United States military continues its encirclement of China and China enters a “state of siege.”

The US conducts military exercises with the Ronald Reagan Carrier Strike Group in the contested South China Sea. These US “maritime Air defense operation[s]” close to the Chinese mainland are a part of significantly increased US military exercises in the area.

The US Defense Secretary Esper announces that the US is withdrawing troops from Germany but moving them closer to the Russian border to serve as a more effective deterrent against Russia.

Russia says it will regard any ballistic missile aimed at its territory as a nuclear attack and will respond in kind with nuclear weapons.

Although the US is formally not at war with any African country, a new report reveals that the United States has special forces operating in 22 African countries with 29 bases and 6,000 troops, with a huge drone hub in Niger that cost 100 + million to build and is expected to have operating costs of more than $280 billion by 2024.

The US continues its assault on Syria, aside from direct military operations, by building up Kurdish proxies in northeastern Syria to protect the oil fields that they are stealing from the Syrian government, a plan hatched long ago. The US says their strategy is to deny ISIS a valuable revenue stream. The same ISIS they used to attack the Syrian government in a war of aggression.

A new document exposes the US plan to overthrow the socialist government of Nicaragua through the United States Agency for International Development (USAID), a traditional US regime change and CIA front organization.

Meanwhile, in Belarus, a place most Americans can’t find on a map, there is another color “revolution” underway.

Continuing its war against Iran and Venezuela by other means, the Trump administration seizes Iranian tankers carrying fuel to Venezuela. “Something will happen with Venezuela. That’s all I can tell you. Something will be happening with Venezuela,” said Trump in a July interview with Noticias Telemundo.

And of course the Palestinians are left to suffer and die as Israel is supported in its despotic policies in the Middle East.

The list goes on and on as the US under Trump continues to wage war by multiple means around the world. But his followers see him as peaceful president because these wars are waged through sanctions, special operations, drones, third parties, etc.

But back in the center ring, the two presidential clown candidates keep the audience entertained, as they shoot water at each other. Trump, who now presides over all the events just listed, and Biden, who enthusiastically supported the American wars against Iraq, Afghanistan, Syria, Libya, etc.

But then the followers of Obama/Biden also see their champions as peaceful leaders. This is even more absurd.

Don’t you like farce?

Besides being a rabid advocate for the invasion of Iraq in 2003 as a senator, Biden, as Vice-President under Obama for eight years, seconded and promoted all of Obama’s wars that were wrapped in “humanitarian” propaganda to evade international law and keep his liberal supporters quiet.

From Bush II, an outright cowboy war-wager who used America’s large military forces to invade Afghanistan and Iraq under false pretensions – i.e. lies, Obama and his sidekick Biden learned to arm and finance thousands of Islamic jihadists, run by the CIA and US special forces, to do the job in more circumspect ways.

They expanded and grew The United States Africa Command (US AFRICOM) throughout Africa. They agreed to a $1 trillion upgrade of US nuclear weapons (that continues under Trump). They disarmed their followers, who, in any case, wished to look the other way.

Out of sight and out of mind, Obama/Biden continued the “war on terror” with drones, private militias, color revolutions, etc. They waged war on six-seven – who knows how many – countries.

An exception to the more secretive wars was the Obama administration’s openly savage assault on Libya in 2011 under the lies of an imperial moral legitimacy. In order to save you, we will destroy you, which is what they did to Libya, a country still in ruins and chaos.

Their equally blood-thirsty Secretary of State Hillary Clinton let the cat out of the bag when she laughed and gleefully applauded the brutal murder of Libya’s leader Moammar Gaddafi with the words: “We came, we saw, he died.” Yippee!

After Libya was destroyed and so many killed in an illegal and immoral war financed with $2 billion dollars from the America treasury, Joseph Biden bragged that the US didn’t lose a single life and such a war was a “prescription for how to deal with the world as we go forward.”

Biden was Obama’s front man on Iraq, the war he voted for in 2003, and wrote an op ed article in 2006 calling for the breakup of the country into three parts, Shia, Sunni, and Kurdish.

When Obama launched 48 cruise missiles and more than ten thousand tons of bombs on Syria in 2016, killing over a hundred civilians, a third of them children, V.P. Biden stood proud and strong in support of the action.

When the US launched the bloody coup in Ukraine in 2014, Biden was of course in agreement.

But we are told that Trump and Biden are arch-enemies. One of them wants war and the other wants peace.

How many Americans will vote for these clowns this year? They are really front men for The Umbrella People, the money people who use the CIA and other undercover forces to carry out their organized crime activities.

As CS Lewis said in his preface to The Screwtape Letters:

The greatest evil is not now done in those sordid ‘dens of crime’ that Dickens loved to paint […] But it is conceived and ordered (moved, seconded, carried, and minuted) in clean, carpeted, warmed, and well-lighted offices, by quiet men with white collars and cut fingernails and smooth-shaven cheeks who do not need to raise their voice.

In the 2016 presidential election, Hillary Clinton and Donald Trump received 129 million votes out of 157 million registered American voters eager to believe that this system is not built on imperial war-making by both parties.

Perhaps that’s a generous assessment. Maybe many of those voters believe in the USA’s “manifest destiny” to rule the world and wage war in God’s name. I hope not. But if so, you can expect a big turnout on November 3, 2020.

In any case, it’s quite a circus, but these clowns aren’t funny. They are dangerous.

“But where are the clowns?
Quick, send in the clowns
Don’t bother they’re here”

Don’t you like farce?

Edward Curtin is a writer whose work has appeared widely. He teaches sociology at Massachusetts College of Liberal Arts. His website is He is the author of the new book Seeking Truth in A Country of Lies

can you spare $1.00 a month to support independent media

Unlike the Guardian we are NOT funded by Bill & Melinda Gates, or any other NGO or government. So a few coins in our jar to help us keep going are always appreciated.

Our Bitcoin JTR code is: 1JR1whUa3G24wXpDyqMKpieckMGGW2u2VX

4.7 29 votes
Article Rating
Inline Feedbacks
View all comments
no more lies
no more lies
Aug 26, 2020 5:50 PM

The endless mention of “nuclear weapons”, systems that may not even exist… Hiro/Naga were firebombed…

“Death Object: Exploding The Nuclear Weapons Hoax” – Akio Nakatani (great book)

Time to wake up folks, they have lied to us about EVERYTHING, as they continue to do so. The whole world’s a stage

Voxi Pop
Voxi Pop
Aug 25, 2020 3:49 AM

The Clowns are literally here

We Will Mock U
An Anthem, a Meme and a Laff Finally!
When clowns wigs are deployed, you know the resistance has begun

Martin Usher
Martin Usher
Aug 25, 2020 12:15 AM

I think ‘clowns’ in this context is probably more like rodeo clowns. These guys hide in casks in the arena and if there’s a problem with the event — a rider’s been thrown and is being threatened by an animal — then they pop up and perform two functions, one being to distract the animal, the other to help get the competitor out of the arena.

That said, turning your back on the process isn’t going to change anything. We get the circus every few years because it gives the process legitimacy but realistically its going to happen whether we approve or not. (Surely that’s one lesson that was learned from Iraq2? You can lie your way into an optional war, people can call you out on it but it will go on anyway because it relies on the mass of people having a relatively short memory and attention span.) So you have to get involved even if the expected benefits are modest; you might not be able to change anything but at least you go on the record explaining what you think is wrong.

Also, remember all these people think they’re doing the Right Thing. We need to chip away at their armor of self-confidence.

el Gallinazo
el Gallinazo
Aug 24, 2020 2:11 PM

Instead of “debates,” Biden and Trump should enter the stage with a case of those old fashion seltzer bottles each and cream pies, and squirt and throw them at each other. I might even watch that for 5 minutes

Aug 24, 2020 9:12 PM
Reply to  el Gallinazo

Using this approach, they could eliminate the farcical “election” altogether and simply award the Oval Office Throne to the participant who didn’t get confused during the heat of the competition, and began to squirt and cream pie himself.

Aug 24, 2020 1:22 PM

Trump is cleaning up the mess the other idiots left him.

Aug 24, 2020 4:09 PM
Reply to  Hank

I’ll grant you that he is, occasionally, doing just that – but purely by accident.

Aug 25, 2020 1:47 AM
Reply to  wardropper

In 4 years he has done more than Slo Joe accomplished in 47.

Aug 25, 2020 3:01 PM
Reply to  JONES

My cat has done more in 4 years than Slo Joe accomplished in 47, so I’m still not going to pretend that Trump’s agenda is for the good of the American people…
Washington is borked, and it’s borking the rest of the world as it sinks.

Aug 25, 2020 1:15 PM
Reply to  Hank

Others may contend that – Trump is the mess …

Aug 24, 2020 10:11 AM


I cannot express how mind boggling to be reading over the last 4-6 weeks articles like this that are saying what I have been saying for the last 5 + years. Along with that, the most incredible mind blowing “I told you so” deja vu kick ass validation that helps make up for all the ad hominem attacks over the years.

That being said, we are never going back to “the way things were” and the most important thing people need to realize is that this is totally a spiritual battle that just so happens to manifest itself in the five senses world we live in temporarily. If you don’t understand that, you will not be able to understand any of it.

That being said, get your spiritual house in order. Not a believer? Pray for revelation like your life depends on it. Because it does . . .

Romans 10:9

Aug 24, 2020 10:22 AM
Reply to  ToS

Eyes Open
Eyes Open
Aug 24, 2020 2:13 PM
Reply to  ToS

Pray to a god who let this happen?

Aug 24, 2020 4:21 PM
Reply to  Eyes Open

To my mind, nobody LET this happen. Bad human beings – or at any rate weak ones – MADE it happen, and it’s their names I’m interested in publicizing. We are always going to have scum floating near the surface of our existence, but if we don’t mind getting our hands a bit dirty now and then, we can skim it off, disinfect it, or just let it shrivel up.
Seriously, I can’t even imagine a world with mature human beings in it, where all the bad things are removed by a benevolent god and only the good things remain. If that was the situation, we wouldn’t even know what a good thing was. We would all be asleep.
I honestly believe the purpose of human evolution is to learn how to wake up, if only because at least some of us sense that we need to. Surely having a god yell at us, “Wake up!” every morning wouldn’t work, although of course he may have already tried that…

Aug 24, 2020 5:57 PM
Reply to  Eyes Open

He’s not talking of a god – he’s talking of spirituality … a serious difference !
If you don’t get it, try again. Some never will …. and I’m a born atheist, never opened a bible to read in my life … and I understand what he’s on about entirely.

Eyes Open
Eyes Open
Aug 24, 2020 6:01 PM
Reply to  pump

Spirituality is not going to save us from this political/economic/ideological attack unfortunately.

Mass protests in Italy forced the Italian government to cancel their second lockdown.

I’m all for spirituality.

Aug 24, 2020 8:22 AM

The VAXX Report (2020) Free PDF×755.jpg

Author’s note:

For the last month and a half I have been generating this 92 page document, based on the vaccine notes (compiled by Charles Giuliani) which I have finally turned into a downloadable PDF. It truly has been hard work for me as, among other things, I have done an extensive photo-research to illustrate every page. I think people will be more willing to read this report if it comes as something rather visual than just a document with content text and no images, thus they will be able to connect the dots much more easily as well. The layout’s design is very simplistic (except for the cover), nothing fancy there, and I prefer it this way for a number of reasons. The PDF is interactive, the reader can double-click on the sky blue text and it will take him/her to original information sources and videos online.

I expect from everyone here, who is genuinely concerned with these matters, to do their part and spread this information like wildfire. Send an email with this PDF (it’s only 5MG size) to relatives and friends, most especially to those who are still in vaccine-hesitant mode. It is important.

All in all I hope to be able to go back to my regular boring articles on painters and such soon. After so many weeks working on this thing I really feel like going back to that for a change……………”


Aug 24, 2020 5:49 AM

Russia says it will regard any ballistic missile aimed at its territory as a nuclear attack and will respond in kind with nuclear weapons.”

Short of Armageddon we shall never know, but given that virology and vaccines look like a gravy train with useful side effects then there is the distinct possibility that Nukes are a forerunner.

Alexander P. de Seversky surveyed the Hiroshima and Nagasaki bomb damage and concluded it looked just the same as all the other Japanese cities that had been fire bombed with napalm. Perhaps Oppenheimer et al simply failed to produce the conditions needed for an explosive fission chain reaction – not unlikely given the limited time and computational power available. Perhaps a runaway chain reaction is just a wild idea, and never has been proven. But since the power it bestows is the same if it works or not (if you can keep the secret) it hardly matters.

‘Little Boy’ (the Hiroshima bomb) was never tested prior to dropping it. There had never been a nuclear explosion anywhere on Earth at the time it was mobilised. Nuclear bombs today are surprisingly still the ones from the 1960s with minor upgrades. Apart from 1945 we take it all on trust. The images of mushroom clouds may not reliable evidence given what we know about the Laurel Canyon studios, and Apollo if you like. 

Bonkers as it seems, a complete failure of the chain reaction hypothesis up to the present day would explain why nuclear weapons have never been used since 1945. Why they were not used in the Korea when there was every reason to do so. Why numerous Cold War accidents and incidents never resulted in an explosion. It would explain why the Nuclear Test Ban Treaty and Outer Space Treaty and various arms limitations were signed so easily. Perhaps also it explains the vast sums spent on particle accelerators, there is still hope of making a breakthrough… if not just part of the same old gravy train.

Something that began as a wartime deception ‘mushroomed’.  Japan didn’t care much. There was never a point to withdraw and all the benefits of a real weapon accrued to all allowed in the club. Even cheeky Kim gets to stay. Nobody in manufacturing or the armed services would need to know that the bombs were dud. Production, deployment and politics (except at highest level) of nuclear weapons would continue just as if they worked.  
This would explain why aggressive foreign policy takes no account of Mutual Assured Destruction. Why public fear of imminent destruction is no longer stoked by the media. The Doomsday Clock gets a dust down as it approaches ever closer to midnight, but who cares?

Akio Nakatini Death Object: Exploding The Nuclear Weapons Hoax

Aug 24, 2020 4:29 PM
Reply to  martin

The human mind can only handle one horrific revelation at a time, however…
My mind is fully occupied with the covid hoax right now.
If we ever manage to deal with that, I’ll be right on this one.

Aug 25, 2020 11:10 AM
Reply to  wardropper

The Nakatini book is a delight to read both from historical and technical point of view.

Aug 25, 2020 3:04 PM
Reply to  martin

Sounds interesting. These days, I’m not closing my mind to any possibility – not even to the remote chance of stumbling upon the truth…

Aug 24, 2020 5:31 AM

Clowns to the ring
ring to the clown
hocus and pocus
circle them – around.

Aug 24, 2020 1:17 AM

“I don’t think we ever should ever shake hands ever again, to be honest with you.“ Fauci

Apart from the thrice reference to the word “ever”, when someone ends a statement with “to be honest with you” I know that the probability of them telling the truth is somewhere in the 0.26% range. Or rounding up, 0.3%

It would be quite ironic if all the germaphobes in the world came to realize that viruses were a manufactured and propagated fraud by Rockefeller and the medical industrial complex.

John Goss
John Goss
Aug 23, 2020 11:19 PM

Clown on a bike

Suddenly you were there,
Arrived just like the bear
arrived at Paddington.
But why Birmingham?
That we may never know.
All the way from Mexico,
some epic cycle hike
on a penny farthing bike,
wielding a crepe bouquet
– a faded paper spray –
in white-gloved hands
through unknown lands.
Red nose, hair, lipstick,
all credit to the dipstick
that created unbeknown
a trademark for a clown:

los gatos hecho en Méx

On each cheek appears
those imitation tears,
yet somehow you beguile
with an entertainer’s smile.
Bracers painted, trousers too,
garish stripes of green and blue,
buttons painted gold.
Did they break the mould?
Noone can see your tootsies
too small for your bootsies,
with all of you recycled
no way you ever cycled.
Say, how does one cacher
the art of papier mâché?
They say a clown is made
from tricks of the trade.

los gatos hecho en Méx

Charlotte Russe
Charlotte Russe
Aug 23, 2020 11:19 PM


Like a Hollywood production every four years the political duopoly yells lights, camera, action and the show begins. 

I bet most don’t know Kellyanne Conway’s husband George Conway co-founded The “Lincoln Project” comprised of neoconservative “never Trump” Republicans. And I have a suspicion the hooligans at BLM demonstrations (Antifa and QAnon) are probably two opposing factions within the security state.

When you cut through all the window dressing and stage props it doesn’t make a bit of difference whether Trump or Biden is President. Afterall, didn’t Biden assure wealthy donors at a ritzy New York fundraiser that “nothing would fundamentally change” if he is elected. Surely, you must take him at his word. There’s five decades of reactionary warmongering legislation to bear this out.

Every war criminal from the George Bush administration is zealously supporting Biden. Trump is disliked by a bunch of security state ghouls because he’s crude and not a refined steward like snake Obama. Trump screams out from the top of his lungs the US is absconding with Syria’s oil. The Orangeman is incapable of acting like the charming duo Obama-Biden who hypnotized progressives for eight years into a state of catatonia. There’s some to be said about a loudmouth who rips a festering bandage off of an infected wound. Everytime Trump moves his lips an oozing band-aid is abrasively pulled away exposing another glimpse at the bloodthirsty rapaciousness of the US Empire.

More repulsive than Trump are the sleazy lying salesman littering the political duopoly. You wish a warning sign would appear every time they spoke saying: “that’s another lie.” Trump lies all the time but you know it immediately–and you laugh because it’s so obvious. Obama-Biden-Harris smother their lies in the “redolence of woke politics.” Mellitus speeches obscure vicious foreign policy. In the end, it was Nobel Peace Prize Obama who expanded two wars into seven.

“If Obama apologized for 1 civilian drone victim every day, it would take him 3 years.”
Covert operations, directed by the CIA and military, resulted in the deaths of as many as 5,160 people, including 1,124 civilians.
Biden-Harris talk about the soul of America, but how did that soul searching go when middle-class Americans saw their wealth decimated by the subprime mortgage debacle. It was blacks who took the heaviest blow since so much of their wealth was tied up in home ownership. Mnuchin’s OneWest Bank in California illegally evicted thousands, but momala Kamala refused to prosecute, because the crook Mnuchin donated to her campaign.

“In late 2008, while the global economy was collapsing, Mnuchin and some partners purchased the failing bank IndyMac and turned it into OneWest, which grew into the largest bank in Southern California. OneWest developed a reputation as a Foreclosure Machine” and Mnuchin himself has been dubbed the “Foreclosure King.”
A 2013 memo from the California attorney general’s office was leaked indicating that OneWest allegedly engaged in “widespread misconduct” to boost foreclosures, including the backdating of mortgage documents. In light of the memo, the nonprofit watchdog Campaign for Accountability  called on the Department of Justice to investigate OneWest for “using potentially illegal tactics to foreclose on as many as 80,000 California homes.”  

In the final analysis, the DC political swamp is a festering septic system attracting multifarious interbreeding vermin–so wouldn’t it be nice if an election is held and no one shows up to vote………

comment image

John Ervin
John Ervin
Aug 24, 2020 12:13 AM

Yes, but where the masks? And shouldn’t there be a chiseled “1963” on the headstone?

Charlotte Ruse
Charlotte Ruse
Aug 24, 2020 12:38 AM
Reply to  John Ervin

Or 2003 the year Bush invaded Iraq.

Sgt Oddball
Sgt Oddball
Aug 24, 2020 12:26 AM

The donkey and elephant should be peeing on it, as well.

Charlotte Ruse
Charlotte Ruse
Aug 24, 2020 12:47 AM
Reply to  Sgt Oddball

Maybe they’ll do that when they finish dancing…….

Aug 24, 2020 1:07 AM

I didn’t know that George Conway co-founded “The Lincoln Project”. But then, I’ve only seen Kellyanne and George Conway out of the corner of my eye, so to speak. I don’t know who they are, except that they are apparently (self-)important Beltway celebrities.

Pardon a “lookist” observation, but strictly as a matter of physiognomy, they strike me as egregiously mean-looking and ugly. I only know them by thumbnails in the aptly-named “Yahoo” website, which I masochistically glance at to see what’s being fed to the yahoos.

Almost every day, it seems, there is a thumbnail and a blurb for some sensational account of what Kellyanne or George did or said, typically with outrage and high dudgeon. She always looks grim and bitter, and he always looks porcine. As Ed Grimley might say, I find it sad and alarming that this sour couple could acquire a constituency and be deemed “influencers”.

Charlotte Ruse
Charlotte Ruse
Aug 24, 2020 3:51 AM
Reply to  Ort

A bit of cognitive dissonance wouldn’t you say that Kellyanne’s husband founded the Lincoln Project…….🤡

Aug 24, 2020 3:17 AM

Conway and Trump’s twitter wars were as fake as the Russiagate Ruse, which Trump was in on from the very beginning. Carter Page is an overused asset merely to obtain FISA warrants. His background as a cut out at Merrill Lynch in Moscow is a telltale sign.

It’s all fake. Shakespeare knew that all the world’s a stage even back then.

Secret societies keep their secrets.

Charlotte Ruse
Charlotte Ruse
Aug 24, 2020 4:24 AM
Reply to  Researcher

There’s no business like show biz.

John Ervin
John Ervin
Aug 23, 2020 10:35 PM


[I’ve been a LA Dodgers fanboy since 1960 when “immortal” pitchers Sandy Koufax and Don Drysdale ruled the roost in quite legendary ways, sportswise. (When Big D didn’t show up to call an Expos game with the Dodgers in Montreal some years after his player retirement, they found him, still pretty young, but dead, in his hotel room of a heart attack: they were startled to find one of the few things he had with him on the road in his night stand was a cassette recording of Bobby Kennedy’s victory speech, among his last words, in which he salutes Drysdale, as a hometown aside, for having that very night just set the record for most consecutive scoreless innings in ⚾ history ~~ 57+(?) I believe. It was touching that so few had known about it.]

I’ve been a big fan too of this young lad Cody Bellinger, been following his play since his first at bat in Dodger Blue a few years ago, scouted him truly as to great things coming, and thru last year when he hit so unconsciously and unbelievably that there were national pundits noting that, whatever followed, it was one of the greatest stretches in over a century and a half of the sport, eclipsing even some of the freak stats of il Bambino, The Babe (Ruth). Now he’s reigning MVP of the National League.

Last night he hit the second walkoff (for UK, Brits, and others, i.e.: game over, everyone walks off the field of dreams) home run of his young career.

Many will find this CoronaCast revealing, if surreal:


Bellinger homers in 9th as Dodgers defeat Rockies 4-3

JOE REEDY (AP Sports Writer)
August 22, 2020, 10:33 pm

LOS ANGELES (AP) — Cody Bellinger didn’t know until first base umpire Bill Miller signaled home run that he had given the surging Los Angeles Dodgers a 4-3 victory over the slumping Colorado Rockies on Saturday night.

After rounding third base to fake crowd noise, seeing cutouts in the Dodger Stadium stands and not being mobbed by teammates at home plate, he admitted it was a satisfying win albeit bizarre at the same time.

”The crowd noise was good but the celebration was strange with everyone jumping with their hands in the air. It felt like a (Nintendo) Wii sports game,” Bellinger said.

The reigning NL MVP drove a slider from Daniel Bard (1-2) just over the glove of Rockies right fielder Sam Hilliard for his seventh home run of the season and the second walk-off shot of his career. Bellinger said he lost track of the ball and manager Dave Roberts said it was weird to judge because the line drive had plenty of top spin.

***After everyone was sure it went over the fence, though, Roberts’ first instinct was to yell to his players to properly social distance during the celebration at home plate.***

Such is life in sports during the coronavirus pandemic.

”We’re used to jumping on each other so I was trying to do my part,” Roberts said. ”We miss the fans every game but this is the first time where it really showed with the climax of a walk off and they would have been on their feet.”

Chris Taylor also homered for the Dodgers, who have won 10 of 11. They are 12-2 this season when hitting at least two home runs.

Kenley Jansen (1-0) got the win after coming on to get the last out of the ninth inning.

Hilliard, who homered for the Rockies, thought he was going to rob Bellinger at the wall and was surprised the drive had enough distance. Colorado has dropped six straight overall, and 15 of its last 16 at Chavez Ravine.

”It just kind of snuck out,” Hilliard said of Bellinger’s home run. ”It’s frustrating. We definitely want to beat this team.”


[DISCLAIMER: with the circus-themed essay and the author’s known history of basketball zealotry –something I share if more as a religion than a sport, this thread seemed fit to post this weird reportage: right time, right place, right “season” though surreally so.]

“In Islam we think of basketball as a religious exercise, as it purifies the work ethic.”

(NBA Hall of Famer) Hakeem Olajuwon, 1995, after winning back to back NBA rings/titles

John Ervin
John Ervin
Aug 23, 2020 10:53 PM
Reply to  John Ervin

Adding magic to myth and madness, last night was a night to honor Kobe Bryant at Dodger Stadium, on what would have been his 42nd birthday. He can be seen online at games there, in Dodger Blue, and was seen as well by yours truly, as we passed each other more than once at a local church in Newport, O.L.Q.A, on our way to Communion. He took his family to pre-dawn service there, in the dark, a couple hours before he and his daughter Gigi, 12yo hoops phenom, were killed (or rather clearly, by enough facts in evidence, assassinated). Only a LONG half year ago.

Sgt Oddball
Sgt Oddball
Aug 24, 2020 12:32 AM
Reply to  John Ervin

”The crowd noise was good but the celebration was strange with everyone jumping with their hands in the air. It felt like a (Nintendo) Wii sports game,” Bellinger said.

…Ay John, y’know how eSports tournaments have been coming on in leaps and bounds in recent years, big money getting involved and all that?…

…Well now you know why…


John Ervin
John Ervin
Aug 24, 2020 4:36 AM
Reply to  Sgt Oddball

The temptation to digitize beyond a need or sound purpose is the thing: the thing that’s going to cost us big-time. If I were a sports superstar I’d be concerned about body snatching.

Tolle said something pithy, that cleverness devoid of wisdom is about the most dangerous and destructive thing afoot, now.

The founder of Netscape remarked, “Software will eat the world.”

Only heaven-sent gifts will stop it now. Stop the “old” consciousness, the accumulation of endless digits, untethered to real values. “10011010100 etc”

” A new heaven and a new earth”.

We await!

John Ervin
John Ervin
Aug 25, 2020 2:51 AM
Reply to  John Ervin

Errata to soothe the sensibilities of baseball statisticians: RFK among his last words were those to congratulate Drysdale for having just pitched his 6th consecutive shutout, almost unheard of, not his record 58 &2/3 scoreless innings (we were listening decades later when Orel Hersheiser broke that, in Blue). This excerpt from Wiki:

“Among the personal belongings found in Drysdale’s hotel room was a cassette tape of Robert F. Kennedy’s victory speech after the 1968 California Democratic presidential primary, a speech given only moments before Senator Kennedy’s assassination. In the speech, Kennedy had noted, to the cheers of the crowd, that Drysdale had pitched his sixth straight shutout that evening. Drysdale had apparently carried the tape with him wherever he went since Kennedy’s murder.[14]”

[Knowing the cabals’ Guinness Record-shattering animus for t)All Things Kennedy, it would never startle me to find Drysdale’s fatal heart attack, alone, on the road, at 56, was induced. Like my cousin and ardent HUAC foe, actor Roman Bohnen.

Or just some related issue, like not being a cookie-cutter Reep jock warmonger. But that’s just because I’m such a knee-jerk Conspiracy Theorist. Hear me people?! LOL😝😰😵😷]

Aug 23, 2020 9:17 PM

Was there that much voter turnout in 2016? Did Hillary get 26% of the popular vote and Trump got 23% leaving 51% of the popular who voted for neither?

Aug 24, 2020 9:20 AM
Reply to  zdb

same with u.k 66 million 24mill voted and they call it a majority
it not it a minority

Aug 23, 2020 8:47 PM

There was no pandemic- never- nada-zilch- not anywhere.

There were large scale social crimes carried out.

John Ervin
John Ervin
Aug 23, 2020 10:44 PM
Reply to  Maxwell

Got that right, and ongoing.

Aug 23, 2020 8:05 PM

left and right mean nothing – it’s about those with power and those without. Socialism for the powerful and feudalism for the rest. Anyone that doesn’t see that now, never will.

John Ervin
John Ervin
Aug 23, 2020 7:12 PM


“When the business man rebukes the idealism of his office-boy, it is commonly in some such speech as this: “Ah, yes, when one is young, one has these ideals in the abstract and these castles in the air; but in middle age they all break up like clouds, and one comes down to a belief in practical politics, to using the machinery one has and getting on with the world as it is.” Thus, at least, venerable and philanthropic old men now in their honoured graves used to talk to me when I was a boy. But since then I have grown up and have discovered that these philanthropic old men were telling lies. What has really happened is exactly the opposite of what they said would happen. They said that I should lose my ideals and begin to believe in the methods of practical politicians. Now, I have not lost my ideals in the least; my faith in fundamentals is exactly what it always was. What I have lost is my old childlike faith in practical politics.”

From: “The Ethics of Elfland” in Delphi Works of G. K. Chesterton

“Impartiality is a pompous name for indifference, which is an elegant name for ignorance.”

The Speaker (15 December 1900


“It is a strange courage you give me,
ancient star.

Shine on in that darkness
to which you lend no part.”

— William Carlos Williams

Big B
Big B
Aug 23, 2020 6:17 PM

Thesis Seven.
Separation is itself an integral part of the unity of this world, of a global social practice split into reality and image. The social practice confronted by an autonomous spectacle is at the same time the real totality which contains that spectacle. But the split within this totality mutilates it to the point that the spectacle seems to be its goal. The language of the spectacle consists of signs of the dominant system of production — signs which are at the same time the ultimate end-products of that system.

The system of signs is the self-reproduction of the system of signs: which is as a reproduction of the significance of the dominant system of production of signs. In other words: the language-faculty – as the total set of the signification of signs (not merely semantics but semiotics) – is the Integrated Spectacle. And all of those who share the consensual domain of the communities of signification are participants in the representations and reproductions of the Spectacular.

That’s everything and everyone.

Fifty years on in the auto-description and autonomy of an econometric signification Spectacular: there is no ‘outside’ ….no “hors Spectacle”. The linguistic-imagic totality is a closed cycle recuperation and reproduction of the consensual dominant domain of significance. And our institutions and governance structures objectivate and institute what is co-constituted and co-consensually agreed as the spectacular objectives of a collective desiring.

Desiring and clinging to things like identity, the right to be recognised, the will to an instrumental rationality of desire for private property, the defence of naturalised slavery, ethnocentrism, androcentrism, an Aryan caste system, self interest maximisation, rational actor theory, and of course, an econometric infinity of self-maximisation flows of monopoly money. All brought to you by the pre-nomial, pre-figured and pre-imaged letter <I> as the originary sign of the split from reality into imagery.

If you want to quote Debord: quote Debord ….but quote the full context. Every sign on every page, in every text, in every mind, is split from its signification. The signified is a shape, a shade, a phantasm of a mental image. The sign – the object – is nowhere to be seen. The interpretation of the real is more like the psychoses of an Arthur Fleck ….the clown is the Joker.

No one is listening: but words do not function by sense and reference. They never have. The proof is actually very simple: there are not enough words for proper determinate naming (names naming extra-linguistic referents as a one-to-one predication). Homonyms and polysemy (the at-least doubling of names) destroys the canonical theory of naming.

Following this: words become context sensitive ….carrying different senses in different texts (cf. Frege’s Puzzles). Which further negates the descriptive truthfulness of sense and reference. Words refer only to words in a play of difference: which is all sense and no reference.

How do we know this? The father of modern linguistics – Ludwig Wittgenstein – told us so when he refuted his earlier Picture Theory (of sense and reference and language as truth and verification).

As for objectivism, truth, and literal descriptivism (verificationism)? Language is figural, speculative and highly metaphoric. Sense is said to “transact” from language domain to language domain: with sense referring back to a non-metaphoric linguistic kernel. Set-categorical theories are merely “family resemblances”; etc.

So where is the world-disclosure “out there” to which the words refer, correspond, and represent?

Language is embodied and the linguistic kernel is grounded in our embodiment. Language is in part biologically determined (ethogrammatic – based on the full range of bodily movements, orientations, cardinal points, count numbers; etc) and in part a cultural orientation reflex of a domain specific cognitive mapping. Beyond the range of explicit deixis – where the <I> is demonstratively the enunciation of a particular speaker – and the referential is demonstratively a particular object or feature – the implicit deixis of “this”, “that”, or “there” – beyond that face-to-face communal cultural horizon ….language becomes more and more abstract and participatory sense-making becomes more and more strained.

The language domain for the ‘exterior world’ is within the embodiment of the language-faculty. The exteriorised ‘extra-linguistic’ domain of ‘out there’ is the Spectacular ….the exteriority of sense for all native speakers. The ‘in here’ is an indirectly public idiolect (cf. private language argument) which is the incoherence of a separation from the dominant signs of the spectacle.

Language is is the way we split our reality. The split is the spectacle.

What sense-making do you think is left to a globalised, digitised horizon of the spectacular ….where even full stops are now a mark of abruptness and anger?

Language stopped meaning decades ago: with the advent of writing and then administration and bureaucracy most academics say. It is now totally disembodied and autonomous. Words have no real extra-linguistic referential power and they refer endlessly to themselves in chains of dominance and non-signification. What they do have is a communal imaginability: which allows us to imagine a world by exteriorising it.

Separation is itself an integral part of the unity of this world, of a global social practice split into reality and image.” By a shared cultural sense of imaginability.

We’ve known all this for decades. Cognitive linguistics is in its third or fourth generation. Sense and referential sense-making is an integrated incoherence of the communal spectacle. And yet tomorrow will will pick up todays totalising non-sense all over again.

Tell me. Just who are the clowns?

Hayward James
Hayward James
Aug 23, 2020 10:53 PM
Reply to  Big B

Dammit, I had things to do today. Your post is making me stop and question everything again. There are disclosures, even constantly appearing, that afford awareness upon which we can act. Then there are intrusions such as yours that might have us stop all action, as useless and complicit. Yet not from futility (although that is also true) but from the pure laugh of existence, in which we can choose to play, or not.

Aug 24, 2020 12:30 AM
Reply to  Hayward James

sure, buddy.

Aug 24, 2020 2:35 AM
Reply to  Hayward James

He did warn us by calling it thesis7… i skipped right through it. Thanks BigB

Aug 23, 2020 5:32 PM

‘Trump is – fact of the matter, the most dangerous figure in human history. Literally, there has been nobody else- Hitler, anyone else, who is dedicated to destroying the prospects of human life on Earth in the short term, and that is exactly what he is doing.’

Noam Chomsky on Young Turks, Aug 2020.

They should not be interviewing him at his age to be honest. Trump is a zionist traitor of the highest order, but to blame what’s coming entirely on him is not really right, it’s not helping matters. He’s just the guy off the TV. A little kid just got beaten up by adults for wearing a Trump hat outside the Biden rally. Statements like Chomsky’s are fuelling such horror.

Lost in a dark wood
Lost in a dark wood
Aug 23, 2020 10:27 PM
Reply to  crank

So Chomsky is now pushing global warming crap; and I presume he was given a script. It starts at about 19:45:

Aug 23, 2020 10:39 PM
Reply to  crank

If Gnome Chumpski says so, it must be right.

Hayward James
Hayward James
Aug 23, 2020 10:48 PM
Reply to  crank

In the Trump era, I find insight in applying Debord. “In a world that is really upside down, the true is a moment of the false.” If the creative destruction of Trump scares Chomsky to this absurd extreme, then his prior political claims are rendered insufficient to our new complexity. I have to dismiss his pretense to foresight. Liberation is also possible now, in a world of such rupture and devoid of consensual authority.

John Ervin
John Ervin
Aug 23, 2020 11:08 PM
Reply to  crank

Chomsky, good or bad, or unlimited hangover that he is, is expressing here a certain truth that, all too arguable, that so many of Trump’s policies are weaponized by predatory capitalism, to inflict incalculable and unmatched damage on human interests. For the short term bang for the buck. Unlimited damage.

Nothing new, Orange Man’s always been that way, all about that score, look it up. He called that feral snake Roy Cohn his “mentor”. Way back when.

If anything, you can make the case that Chomsky is chastely understating the Reality (TV).


“You should dream more, Wormold. Reality in this century is not something to be faced.’

— Graham Greene, “Our Man in Havana”

Aug 24, 2020 12:38 AM
Reply to  John Ervin

Funny that I’m at the moment reading Our man in Havana… I must be at my 15h Graham Green in a row… small world, and bizarre

Aug 25, 2020 10:08 PM
Reply to  John Ervin

Don’t worry, everything will be just peachy once we get rid of the Orange Baboon and instalL Creepy Joe and Kabbala Haaretz in the Oval Office.
No more wars, no more racism, no more sexism, universal peace and brotherhood and justice and happiness will instantly break out over us.

John Ervin
John Ervin
Aug 25, 2020 11:39 PM
Reply to  paul

2 “wrongs” don’t make a right.


Or a Left.

In the war of attrition against us, this way, there are endless offerings from the one-headed monster, the duopoly. And the right not to choose is also so choosey.

That may serve as an explanation, but never an excuse — for such monotonous Orangeness


🍑-y + 🍊 : Colour-coordinated 4U

Aug 23, 2020 5:27 PM

As we talk of clowns, tightrope walkers and umbrellas, a song from my time in Brazil during the military dictatorship. Those Latin American wars on dissent are very much closer to home than you think – being linked at so many levels to the Paperclip Nazis, the Europeans who informed U.S. politics, foreign and domestic. It merely adapts to the fashions of the time.

Anyhow, a short introduction: the singer, Elis Regina, was accused of complicity for failing to protest sufficiently the dictatorship of the 1960s-80s until, that is, she performed what became a celebrated tribute to the exiles who “vanished as if on a rocket’s tail” and to the disappeared, upon whose “tortured stains” sucked the “blotting paper of the sky”.

The Drunk and the Tightrope Walker (O Bêbado e a Equilibrista), was written by a psychiatrist turned musician, Aldir Blanc Mendes (who died this May 4th, 2020). The music was composed by João Bosco, and it was performed in 1979 by Elis Regina.

Evening fell like a bridge
A drunk wearing a funeral suit reminded me of Chaplin’s tramp.
The moon, like a brothel madam
begged from each cold star a rented light

And clouds, up there in the blotting paper of the sky
sucked on tortured stains: what crazy agony.
The drunk wearing a bowler hat showed irreverence for Brazil’s night.
My Brazil which is dreaming of the return of Henfil’s brother
and of so many people who vanished as if on a rocket’s tail.

Our gentle mother country is crying
Marias and Clarices are crying on Brazil’s soil

But I know that pain this sharp won’t be in vain
Hope dances on the tightrope with an umbrella
And with each step on this rope you can hurt yourself
Bad luck!
The balancing hope
knows that each artist’s show
must go on

charles kint
charles kint
Aug 23, 2020 5:01 PM

I left the oligarchy and their idea of democracy for the 1% a long time ago
God help us

John Ervin
John Ervin
Aug 23, 2020 11:09 PM
Reply to  charles kint

Unlimited Welfare State: Members Only.

Gary Weglarz
Gary Weglarz
Aug 23, 2020 4:16 PM

A brilliant insightful piece by Ed. The quote from C. S. Lewis is absolutely perfect. –

(“The greatest evil is not now done in those sordid ‘dens of crime’ that Dickens loved to paint […] But it is conceived and ordered (moved, seconded, carried, and minuted) in clean, carpeted, warmed, and well-lighted offices, by quiet men with white collars and cut fingernails and smooth-shaven cheeks who do not need to raise their voice.”)

Aug 23, 2020 9:01 PM
Reply to  Gary Weglarz

I agree, but I trust that despite making a trenchant rhetorical point, Lewis understood that the greatest evil arising from the latter group of quiet men often, even typically, trickles down to sordid “dens of crime”.

I say this because coincidentally, earlier today I watched an interview with Erin Marie Olszewski, the nurse who blew the whistle on the New York Elmhurst Hospital Center’s wantonly homicidal COVID procedures. I’d seen earlier interviews with her, but I was forcefully reminded of the horrific malpractice and appalling attitudes of the medical staff there.

Charles Dickens came to mind! I thought that if Dickens were alive, or had a present-day counterpart, he might create a literary portrait based on Olszewski’s credible and compelling account. A sordid den of crime indeed!

Gary Weglarz
Gary Weglarz
Aug 23, 2020 10:07 PM
Reply to  Ort

Do you have a link to that latest interview with Olszewski? Thank you.

Aug 23, 2020 10:24 PM
Reply to  Gary Weglarz

“Undercover Epicenter Nurse”- Interview with Erin Marie Olszewski • Aug 14, 2020

Gary Weglarz
Gary Weglarz
Aug 23, 2020 10:29 PM
Reply to  Ort

Thank you.

Petra Liverani
Petra Liverani
Aug 24, 2020 6:52 AM
Reply to  Ort

Anything that pushes the existence of a virus is controlled opposition. To understand how the world works you really need to understand that the power elite massively infiltrate the opposition like a mutant octopus and have a complete stranglehold on it. It’s as ascribed to Lenin (but understood by power everywhere and for millennia): “The best way to control the opposition is to lead it ourselves.”

We can also look to Sun Tzu’s Art of War.

If you know the enemy and know yourself, you need not fear the result of a hundred battles. If you know yourself but not the enemy, for every victory gained you will also suffer a defeat. If you know neither the enemy nor yourself, you will succumb in every battle.

The power elite know themselves, they know what bastards they are and they certainly know us much better than we know ourselves. They are not in the least shamefaced in pushing out reams of truth against themselves. What they’re concerned with is maintaining power and they will do absolutely anything including pushing out nasty truth about themselves in that regard.

They also justify what they do because they claim that underneath all the propaganda they drown us in they actually tell us the truth. And I have to say in that they have a point. They really do tell us with their nonsense alleged COVID patients in ICUs coughing all over the show and 90-year-olds undergoing miraculous survivals from potato soup. They really push the ridiculousness of their hoaxery in our faces. As said by, Anthony Daniels in relation to communist propaganda but which, in fact, applies to Western propaganda, if not propaganda everywhere, the purpose of propaganda is not to persuade or convince, not to inform, but to humiliate.
Whom do we blame for that?

They have pushed two major streams of propaganda:
1. Pandemic
2. Virus but not pandemic, response inappropriate, numbers don’t add up

And then there’s all the mini-streams to wind people up:
HCQ, lockdown, masks, vaccines, hand sanitising, social distancing, etc

No “special” virus, no illness, no pandemic which we can determine from multiple angles, including, notably the obviously fraudulent science. All illness and death is simply due to what it’s always been from. This pandemic is the Emperor’s New Clothes par excellence.

My goodness, this psyop is so very, very simple. It’s simply astounding how much material can be generated from precisely nothing to push people’s buttons relentlessly.

I’m so sick of bleating the bleeding obvious.

John Ervin
John Ervin
Aug 26, 2020 12:50 AM
Reply to  Gary Weglarz

In the sulfurous arc sketched by the letters of Screwtape to his nephew in the “confines” of Tempter’s Training College, I became something more than a simple fan of their curator, Mr. Clive S. Lewis: along with “The Moon Is Down 🌒” by Steinbeck, and “Living to Tell the Tale” (Vivir para Contarlo?) by Marquez, Screwtape was a supplement to my scripture about Joseph and his Coat of Coats up thru Moses having thunderous and larger than life adventures on the Mount with handmade Tablets. She had been a lifelong avid reader –she was Fairfax (Hollywood) HS valedictorian, class of ’35, but “autodidacte” thereafter, as young mother of 3.

The suave influence that the revelations of diabolical conspiracies (no theory!) invisibly amongst us have upon our vanity and pride and self-exculpatory flaws of reasonings had upon my mother at her tender (last) age of 91 (she still tap danced spectacularly!) was as profound as it was subtle and strong. And inversely, just as suave as the letters are wicked.

It was all part of the process of her returning to a Church that she had mostly vacated of her interest if not, mostly to please me, always her presence. But 80 years later she had become too blind to read easily, so we would visit and I would read aloud, to her unplumbable delight.

About the date I had read half the letters to her, and to her gradually growing interest, she collapsed in my arms one twilit dawn, shocking both of us, and died of leukemia about a month later, but not without a blaze of glory, some of her rocket fuse lit by her grasp of the backwards logistics of Screwtape, and what they meant for her, for every.

As I squint thus, and so far backwards, I see that I still have the yellowed 1960s paperback version I bought in 1970, after dropping out of HS, maybe really the only paper book that survived the dissolution of 5 book collections I’ve had the last half century, along with somewhere a couple others in the box set of “6 by Lewis”. (Historians say that two letters by St. Patrick are the only manuscripts to survive the “Dark Ages” there, so I see happenstance at work. Or play?)

And from that I then read to her the sly updates of his on “B.asic I.nstructions B.efore L.eaving E.arth” (B.I.B.L.E.). They are really that “good” as a sort of mirror-image catechism. Awesomely pointed.

With that backstory, the introductory note by Lewis then serves yet again as today’s pressing prequel:



“The best way to drive out the devil, if he will not yield to texts of Scripture, is to jeer and flout him, for he cannot bear scorn.”—Luther

“The devill . . the prowde spirite . . cannot endure to be mocked.”—Thomas More


I have no intention of explaining how the correspondence which I now offer to the public fell into my hands.

There are two equal and opposite errors into which our race can fall about the devils. One is to disbelieve in their existence. The other is to believe, and to feel an excessive and unhealthy interest in them. They themselves are equally pleased by both errors and hail a materialist or a magician with the same delight. The sort of script which is used in this book can be very easily obtained by anyone who has once learned the knack; but ill-disposed or excitable people who might make a bad use of it shall not learn it from me.

Readers are advised to remember that the devil is a liar. Not everything that Screwtape says should be assumed to be true even from his own angle. I have made no attempt to identify any of the human beings mentioned in the letters; but I think it very unlikely that the portraits, say, of Fr. Spike or the patient’s mother, are wholly just. There is wishful thinking in Hell as well as on Earth.


PS *Your citation of Curtin’s citation above, Gary, sparked femebran e a quote from that same 1963 preface I’ve carried with me largely intact for the duration: that Lewis said he envisioned the organization of hell not so much as sulfurous ovens in dungeons as a modern and “thoroughly nasty business concern” with “Admin” written on the entry!

John Ervin
John Ervin
Aug 26, 2020 1:08 AM
Reply to  Gary Weglarz

PS I tried to add this to the first paragraph, but the edit had timed out, so I put it here, as explanatory of the LA culture 100 years ago:

…avid reader as Fairfax High (Hollywood) valedictorian, class of ’35, but “autodidacte” thereafter, as young mother of 3. (She had never read the Bible, until I read it aloud, 80 years later, and though she had heard it at church all through her girlhood. As a cradle Catholic, she was conditioned in the 1920s LA culture to let Sunday readings be enough, because there were too many “racy parts” in the pre-Gospel earlier books of the Bible! True enough.)

Gary Weglarz
Gary Weglarz
Aug 26, 2020 1:34 AM
Reply to  John Ervin

Great post John – thanks!

John Ervin
John Ervin
Aug 26, 2020 5:37 PM
Reply to  Gary Weglarz

Thanks, Gary, sorry if the above was garbled, I wrestle with the edit functions here: I had meant to post the 1st Screwtape Letter alongside the above, not long at all, since it is 80 years on just so revealing about the dynamics of critical thinking. Here it is then:




July 5, 1941

My dear Wormwood,

I note what you say about guiding your patient’s reading and taking care that he sees a good deal of his materialist friend. But are you not being a trifle naïf? It sounds as if you supposed that argument was the way to keep him out of the Enemy’s clutches. That might have been so if he had lived a few centuries earlier. At that time the humans still knew pretty well when a thing was proved and when it was not; and if it was proved they really believed it. They still connected thinking with doing and were prepared to alter their way of life as the result of a chain of reasoning. But what with the weekly press and other such weapons we have largely altered that. Your man has been accustomed, ever since he was a boy, to have a dozen incompatible philosophies dancing about together inside his head. He doesn’t think of doctrines as primarily “true” or “false”, but as “academic” or “practical”, “outworn” or “contemporary”, “conventional” or “ruthless”. Jargon, not argument, is your best ally in keeping him from the Church. Don’t waste time trying to make him think that materialism is true! Make him think it is strong, or stark, or courageous—that it is the philosophy of the future. That’s the sort of thing he cares about.

The trouble about argument is that it moves the whole struggle onto the Enemy’s own ground. He can argue too; whereas in really practical propaganda of the kind I am suggesting He has been shown for centuries to be greatly the inferior of Our Father Below. By the very act of arguing, you awake the patient’s reason; and once it is awake, who can foresee the result? Even if a particular train of thought can be twisted so as to end in our favour, you will find that you have been strengthening in your patient the fatal habit of attending to universal issues and withdrawing his attention from the stream of immediate sense experiences. Your business is to fix his attention on the stream. Teach him to call it “real life” and don’t let him ask what he means by “real”.

Remember, he is not, like you, a pure spirit. Never having been a human (Oh that abominable advantage of the Enemy’s!) you don’t realise how enslaved they are to the pressure of the ordinary. I once had a patient, a sound atheist, who used to read in the British Museum. One day, as he sat reading, I saw a train of thought in his mind beginning to go the wrong way. The Enemy, of course, was at his elbow in a moment. Before I knew where I was I saw my twenty years’ work beginning to totter. If I had lost my head and begun to attempt a defence by argument I should have been undone. But I was not such a fool. I struck instantly at the part of the man which I had best under my control and suggested that it was just about time he had some lunch. The Enemy presumably made the counter-suggestion (you know how one can never quite overhear what He says to them?) that this was more important than lunch. At least I think that must have been His line for when I said “Quite. In fact much too important to tackle at the end of a morning”, the patient brightened up considerably; and by the time I had added “Much better come back after lunch and go into it with a fresh mind”, he was already half way to the door. Once he was in the street the battle was won. I showed him a newsboy shouting the midday paper, and a No. 73 bus going past, and before he reached the bottom of the steps I had got into him an unalterable conviction that, whatever odd ideas might come into a man’s head when he was shut up alone with his books, a healthy dose of “real life” (by which he meant the bus and the newsboy) was enough to show him that all “that sort of thing” just couldn’t be true. He knew he’d had a narrow escape and in later years was fond of talking about “that inarticulate sense for actuality which is our ultimate safeguard against the aberrations of mere logic”. He is now safe in Our Father’s house.

You begin to see the point? Thanks to processes which we set at work in them centuries ago, they find it all but impossible to believe in the unfamiliar while the familiar is before their eyes. Keep pressing home on him the ordinariness of things. Above all, do not attempt to use science (I mean, the real sciences) as a defence against Christianity. They will positively encourage him to think about realities he can’t touch and see. There have been sad cases among the modern physicists. If he must dabble in science, keep him on economics and sociology; don’t let him get away from that invaluable “real life”. But the best of all is to let him read no science but to give him a grand general idea that he knows it all and that everything he happens to have picked up in casual talk and reading is “the results of modern investigation”. Do remember you are there to fuddle him. From the way some of you young fiends talk, anyone would suppose it was our job to teach!

Your affectionate uncle

Gary Weglarz
Gary Weglarz
Aug 26, 2020 10:24 PM
Reply to  John Ervin

Really quite brilliant. More to add to my reading list for sure.

Aug 23, 2020 3:39 PM

Failing to condemn and oppose totalitarian, murdering regimes such as Islamist Iran, communist China and starving socialist Venezuela, while assuming evil intent in every US action, exemplifies perfectly the naivety, prejudice, hypocrisy and blindness to horrendous injustice that made me abandon leftism in the first place. This article would be approved by Lenin and other tyrants hating democracy. Those regimes I mentioned are monstrous, and destroy the human rights and freedoms that only western democracy gave the world. All war and violence is wrong, not just when Americans do it.

S Cooper
S Cooper
Aug 23, 2020 4:44 PM

Communist China, Socialist Venezuela?” What is this an advert for “the Roy Cohn Hour?” You sound like the deranged spawn of some Rego Park, CPUSA Stalinoid dilettantes. If you are looking for a really receptive audience for that bilge head on over to the Sheldon Adelson Corporate Enslavement Center and Mutual Admiration Society. They just eat up that crap.

Aug 23, 2020 6:44 PM
Reply to  S Cooper

Your sneering and insulting reveal your hate. As I Keep saying, your intolerance betrays leftist ideals.

Aug 23, 2020 5:06 PM

Whipping up hatred against the US serves a valuable purpose for the owners of the US.
If everyone loved the US they wouldnt be able to start on so many countries, which is led by the owners of the US.
All war and violence comes from one group of people. Those with a keen eye can see who.

Aug 23, 2020 6:42 PM
Reply to  ZenPriest

Where does one find that keen eye, and its guarantee of functioning correctly?

Aug 23, 2020 5:22 PM

Not just WHEN the americans do it. when ? it’s an on going policy of the war mongering yanks, Iran has not fought a war of aggression in over 200 years , the warmongering yanks? since its inception 240 years ago , they have been at war for 225 years with someone , that not a bad record, all the others combined plus a few more you would like to add doesn’t come anywhere near.

Aug 23, 2020 7:51 PM
Reply to  Geoff

Iran peaceful! This dictatorship funds and arms the Hezbollah terror group attacking Israel, the Islamist terror groups ruining Yemen, it is infiltrating and destabilising Lebanon, denies human rights to its subjects, persecutes non-Muslim Iranians, keeps women as second-class citizens, has morality police beat them up in public for refusing the hijab, executes men in public for being gay (including teenagers), imprisons and tortures anyone who criticises and questions the Islamist regime, is busy building one of the largest militaries in the world, and is developing ballistic missiles to carry the nuclear warheads with which the Mullahs openly promise ‘to annihilate Israel’. Iran’s military even write ‘death to Israel’ on their test missiles. Posters can verify all these claims online if they wish, but I’m sure few will bother. As an ex-leftist myself, I know how easy it is to ignore all criticism that leftists cannot perceive reality or see evil which is not western or ‘imperialist’. Lenin, Stalin, Mao and today’s Islamist dictators attract the same accusation. These murdering tyrants hate(d) the freedom, democracy and human rights which only western nations have bequeathed much of the world, unlike so many of their powerless, terrorised subjects. Communists alone have murdered an estimated 120m of their own nations over the last century, and continue to do so. Will you blame yanks for that too? Will you call them the Great Satan, as Iranian politicians and their supporters do? Is inciting or practicing hate and violence morally ok when evil yanks and their evil kids are the target? And why do you hate and scapegoat an entire people, rather than the corrupt leaders and corporate interests leading the innocent into war? Didn’t Hitler hate and scapegoat German Jewry, and doesn’t Xi Jinping do that against the 3m Uigyur Muslims and Tibetans now in his concentration camps? This absurd and irrational bigotry against democratic nations like the US, this moral failure to condemn all hate and violence and war is why I left the left. History shows us that all humans, including leftists, Americans, and even American leftists, can practise hate, war and oppression. Human wrongdoing does not have a specific nationality.

Aug 23, 2020 8:02 PM

This absurd and irrational bigotry against democratic nations like the US, ha ha ha ha ha ha ha ha ha give oo-er you blind imbecile, you could never have had any interest in being on the left, apart from how you dress maybe.

Aug 24, 2020 1:15 AM
Reply to  Geoff

Yeah… blind imbecile, straight to caracter destruction and people are cheering.. you sound like a paid zionist

Sgt Oddball
Sgt Oddball
Aug 24, 2020 12:40 AM

and doesn’t Xi Jinping do that against the 3m Uigyur Muslims and Tibetans now in his concentration camps?

…Hey man, – monkey Xi, monkey do…

Aug 25, 2020 10:18 PM
Reply to  Sgt Oddball

Any advance on 3 million?
Only 3 Million?
How about 6 million, all being turned into soap and lamp shades?

Aug 24, 2020 1:16 AM

Thank you for serving as a target so I can see who’s who

Aug 25, 2020 10:15 PM

Bravo! Bravo!! Encore!!!
You’ve got all the approved AIPAC talking points into the smallest possible space.
Collect your shekels on the way out.

A bit disappointed, though, that you didn’t get in the latest startling revelations about cannibalism and witchcraft in Tehran.

Maybe next time.

Aug 23, 2020 5:47 PM

All war and violence is wrong, not just when Americans do it.

This is true. However, Americans do seem to be rather keen on it, which is why they are hated all over the world.
I too left the Left, but maybe you need to go back and re-learn the bits Lefties actually get right ?

Aug 23, 2020 8:01 PM
Reply to  crank

Like communism is better than capitalism, despite the 120m deaths of those who refused or merely displeased communist dictators over the last 100 years? Is that the part leftists got right? Or was it the bit about evil white people practising slavery (forget all prior human history) when the truth is that they were the only ones in human history known to have ended it? How about the part where white humans are racist, but not humans of other colours? Were leftists right when they told you the story that Americans are hated because they love war more than anyone else? I know, you provide the numbers, evidence and rationale to support your claims about Americans as more guilty than other humans, and I’ll check them and revise my views about leftist truths accordingly

Aug 23, 2020 8:28 PM

This is all ‘my enemy’s enemy is my friend’. It’s an old road that leads nowhere.
America has been dominated by liberal capitalism run in the interests of a private banking cabal for about a century. What hell that has unleashed upon the world !
To criticise that in extreme is not for one microsecond to make any apology for the horrors of Marxist Communism or the identity politics spawn of it which tears our world apart today.
There is a common opposition in both these political movements.

Aug 23, 2020 10:06 PM

Are you, by any chance, being sponsored to write the word ”leftist”? You must have raised a fortune!

(Not that it’s extremely tedious to read post after post in which you say exactly the same thing, of course).

Aug 25, 2020 10:21 PM

Only 120 million?
Surely you can do better than that, old chap.
Blue sky thinking, blue sky thinking.
6 billion, surely.
Must aim higher.

Aug 24, 2020 1:20 AM
Reply to  crank

Americans received the worst education programs and were dumbed down by the real masters. They were told they were the best and they ended up as naive… they are people, like u, and they are being stripped down… like u idiot.. unless you’re exempt?

Aug 23, 2020 5:52 PM

Those regimes I mentioned are monstrous, and destroy the human rights and freedoms that only western democracy gave the world.

Thanks for making me burst out laughing. ;o)

Aug 23, 2020 9:05 PM
Reply to  Gwyn

Did I say anything untrue? Perhaps you could correct me with some arguments and evidence. Also, please explain who gave you your rights and freedoms, such as the freedom to laugh here, if it was not western culture and democracy. Do you laugh at those fighting for absent human rights in communist China and Islamist Iran?

Aug 23, 2020 10:04 PM



(Seriously. People on here couldn’t care less about what you claim were your political leanings in the past). ;o)

George Mc
George Mc
Aug 23, 2020 6:32 PM

I don’t see how you could have left the left. The more you write, the more obvious it is that you were never in the left.

Aug 23, 2020 7:34 PM
Reply to  George Mc

Bingo. Disinformation troll.

Lower the discourse, distract with nonsense. Push the Trump idolatry. Ask childish questions. Repeat empty platitudes.

Fill up the comments page with junk.

John Ervin
John Ervin
Aug 26, 2020 1:28 AM
Reply to  Researcher

Chalk it up to last generation’s neighbourly psyops in USA, “I used to be a Democrat, before I was won over by the wisdom of Reagan’s policies about: _________”

Like they sell prepackaged fireplace logs in markets, that one is ever foisted with still much success on suckers.

As, I suspect you got plenty of that in UK, if you substitute Maggie for Ron.

Aug 30, 2020 8:51 PM

Starving half a million Iraqi children under 5 to death is not the work of Iran or Venezuela, it is the work of subhuman American filth who need to be repaid in their own coin and made to suffer as they have made others suffer.

The babies born with two heads and no faces in Fallujah are not the handiwork of Iran or Venezuela, they are the handiwork of the same subhuman filth you want to slobber over.

Sophie - Admin1
Sophie - Admin1
Aug 30, 2020 8:58 PM
Reply to  paul

What about the Americans who oppose imperialism and who have had their lives ended or destroyed by speaking out against it?

Aug 23, 2020 3:01 PM

The “scientific” paper “Investigation of a COVID-19 outbreak in Germany resulting from a single travel-associated primary case: a case series,” from “The Lancet Infectious Diseases,” is a complete fabrication.

The article claims to document a case where Covid-19 was spread from China to Europe.

The carrier of Covid-19 was Patient 0, a Chinese business woman who traveled from Shanghai to Munich on Jan 19, 2020, to facilitate workshops, and attend meetings with her German colleagues. She showed no signs of illness during her stay in Germany, although she mentions suffering from jet-lag. She returned to China on Jan 22 where she became ill, and on Jan 26 tested positive for Covid-19. It is claimed that, although asymptomatic at the time, she passed the disease to a number of German associates, who then passed it to others. Those who tested positive for Covid-19 (by qRT-PCR) had their virus sequenced. The sequences were submitted to GenBank. Those infected were called the Munich cluster.

One of those infected, Patient 1, is claimed to have caught the disease from Patient 0. Patient 1 then passed the disease to Patient 3. Since Patient 3’s only contact was with Patient 1, this certainly appears plausible, however, this turns out to have been impossible.

Consider the mutations (changes from the standard Wuhan sequence) of Patients 1 & 3.

Patient 1, MT270101.1, SARS-CoV-2/human/DEU/BavPat1-ChVir929/2020, complete genome. ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGT1- (deletion at beginning) C241T (substitution at position 241) C3037T (substitution at 3037) A23403G (substitution at 23403) CCATGTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA29837- (deletion at end)

Patient 3, MT270103.1, SARS-CoV-2/human/DEU/BavPat3-ChVir1020/2020, complete genome. ATTAAAGGTTTATACCTTCCCAGGTAACA1- (deletion at beginning) C241T (substitution at 241) C3037T (substitution at 3037) A23403G (substitution at 23403) TGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA29867- (deletion at end)

Given these, it is impossible that Patient 3 caught Covid-19 from Patient 1.

Relative to the standard Wuhan sequence, the virus from Patient 1 has lost (from its beginning) the segment
However, the virus from Patient 3 has lost (from its beginning) only the shorter segment

Also, the virus from Patient 1 has lost (from its end) the segment
However, the virus from Patient 3 has lost (from its end) only the shorter segment

Therefore Patient 1 cannot have transmitted the virus to Patient 3, unless the virus from Patient 1 somehow found the missing segment AACCAACCAACTTTCGATCTCTTGT, and attached it to its beginning, and also found the missing segment CCATGTGATTTTAATAGCTTCTTAGGAGAA, and attached it to its end, with these attachments occurring sometime during the transmission. But this is clearly impossible.

For the same reason, the claimed transmissions from Patient 4 to Patient 5, and from Patient 5 to Patient 7, are impossible.


Aug 23, 2020 7:37 PM
Reply to  john7

Not bad for a virus that doesn’t exist

Peter Jennings
Peter Jennings
Aug 23, 2020 3:01 PM

Some present day ‘politicians’ want to be rulers of the world, to be written into history as some sort of Caesar. They may get their wish. However, in these days of nuclear weapons it will be a short history, with noone left to read it.

The political system has to be modified and some form of accountability needs to be incorporated to prevent presidents and prime ministers, rogue officials, from ignoring the public, running riot, and making fortunes for themselves and their gangs in the process. What safeguards we currently have in place clearly isn’t working.

Compulsive liars should never be given another public office. It’s naive to deny that some lies will be told on the campaign trail by politicians, but these lies have to stop during their tenure. Those elected who renege on their campaign promises should have their tenure cut short.
Today’s public are supposed to be the most educated yet our political parties consider the electorate too dim to grasp the facts. Obviously, something more is at play.
It seems to me that all main stream political parties have made it quite plain that most of the time they are trying to cover up their past bungling, warmongering, and fund raising, so they may return at a later date when the memory has faded to extract more public funds.

To break this loop, something has to change.

Aug 23, 2020 3:44 PM
Reply to  Peter Jennings

then dont vote the electors must be fucking stupid to keep voting for known liars  pedos, con artists, murderers, time and time again and expecting a different type of politicians and results!!

no sympathy

there is a oldsaying never trust a Tory
never trust politicians they dont represent you
they worked for big business
what part of that do you not all understand..?

Aug 23, 2020 9:51 PM
Reply to  ame

I understand that Labour politicians are better humans than the Tories you clearly hate, but with no reason or evidence to prove your accusation. But I can’t see how hating Jews and honouring their violent killers makes you a better human. Maybe Jeremy Corbyn knows. More importantly, do you think British Tories can manipulate globalist eugenicists like Bill Gates, or big pharma interests like Gilead, rather than the reverse?

Peter Jennings
Peter Jennings
Aug 23, 2020 11:59 PM
Reply to  ame

Hindsight is a very personal affair and rarely makes an appearance on a mass scale. Some time ago, the security forces solved their problems with leaks, rogues and spies, by simply increasing the quality and depth of vetting new recruits.

After thatcher’s secret weapon, the ‘oldsaying’ could just as easily apply to the Labour party.
The system is in place for us to use. Removing big business from the political process would prevent the tail wagging the dog and free thousands of corporate lobbyist to go and do something more worthwhile.

Dave Lawton
Dave Lawton
Aug 24, 2020 12:51 AM
Reply to  ame

Remembering the past I recall Labour facilitating the genocide of millions.And its other human rights abuses.All covered up by its arch propagandist Norman Reddaway.

Aug 23, 2020 5:23 PM
Reply to  Peter Jennings

You dont seem to understand that politicians do the bidding of those who own the world.
A politician isnt going to make it to a position of influence unless they are a snake. Its futile to wish for something else, because that’s not how it works.
Why not focus on who is controlling everything and why?

Peter Jennings
Peter Jennings
Aug 23, 2020 11:36 PM
Reply to  ZenPriest

I for one do not give up so easily.
History is littered with examples of humans creating ‘something else’ and making it work.
We have in this modern age all we need to ensure decent, fair, and efficient governance. It’s the false notion that nothing can be done.

Aug 24, 2020 2:44 AM
Reply to  Peter Jennings

I believe that’s Big Pharma’s motto, and they are doing great!

Aug 24, 2020 2:48 AM
Reply to  Peter Jennings

There’s a criminal at the head of WHO and he’s altered world economy and muzzled everybody… now he’s telling his friends « See? It can be done done, now lets settle our bets » « All right, do you have change for a million »

Aug 24, 2020 7:33 AM
Reply to  Peter Jennings

Any new solution is compromised because the ruling group have way too much power. If they can make it work for them they will hijack it. If it threatens them they will crush it.
The only solution is to name and remove them.

Aug 23, 2020 9:40 PM
Reply to  Peter Jennings

But not from democracy to dictatorship, in which people become subject to unable to speak freely, let alone vote freely.

The Refusers
The Refusers
Aug 23, 2020 3:00 PM

Ironically, our protest rock band The Refusers just released a song titled Clown Show.


“We’re bought and sold, I told you so. Gonna fight it with rock and roll.
Cast off the yoke, go for broke. Cram it down their throats!

Eeny Meeny Eeny Meeny Miny Moe. Wall Street and the government are a joke.

It’s a clown show, Bozo. Clown show, Bozo. Clown show, Bozo.
Bozo, Bozo, Bozo, Bozo clown show!”

Free streaming link to hear our song Clown Show

peter mcloughlin
peter mcloughlin
Aug 23, 2020 2:44 PM

Indeed, the situation is far from funny, especially the growing confrontation with China and Russia, which increasingly looks like world war. But there is a pattern of history here, and blindness to the nuclear cataclysm that awaits.

Germs Bond
Germs Bond
Aug 23, 2020 3:24 PM

China and Russia are part of this Covid hoax. It’s smoke and mirrors.

Aug 23, 2020 7:41 PM
Reply to  Germs Bond

That’s the strange part of this article. On the one hand he refers to the Umbrella people pulling the strings,then implies the political theatre is actually real – ie the US/China conflict. As you say it is a part of the show. The cabal are colluding across the board. In fact I am pretty sure the entire covid hoax was planned out carefully with the Chinese.

Aug 23, 2020 9:24 PM
Reply to  kevinpk

Just because it’s a show means it’s not real? That real people don’t get killed?

Aug 23, 2020 9:53 PM
Reply to  Germs Bond

Chinese scientists in Wuhan even produced and somehow released a fake virus that changed global history. Unless the evil yankees did it, of course.

Aug 23, 2020 2:31 PM

I wonder if Edward Curtin has read about Cybereason and their drills for the upcoming circus finale in November ?
Kind of important context don’t you think ?

Aug 23, 2020 4:25 PM
Reply to  crank

…and because I am at a very loose end, basically waiting around to see what utter shit the powers that be are going to throw into our faces next, I read about the asteroid that will likely strike Earth on Nov 2nd this year.
(Yeah 6 feet diameter…)
Just to jump into the circus hoopla with both feet, let’s draw upon the failed prediction of a catastrophic event involving fire and mass death in Seattle which some random German guy thought was going to happen on 3rd November 2019 (see Adam Green). Let’s say he got the year wrong… by one.
So a mini nuke it is then, in Seattle Nov 2nd/ 3rd, blamed on an asteroid strike, media crisis management by Cybereason (Unit 8200).
God I am at a loose end.
Vote Harris/Trump/Crusty the Clown.

Aug 23, 2020 8:12 PM
Reply to  crank

I’ve been to that Observatory on Palomar mountain many times.

CNN just published a story on it. Maybe you’re on to something.

George Mc
George Mc
Aug 23, 2020 2:27 PM

I just caught a Caitlin Johnstone tweet that the lockdown was halfway through and would be over in 3 weeks. In what part of the world did the lockdown last 6 weeks?

Aug 23, 2020 4:28 PM
Reply to  George Mc

In what part of the world did the lockdown last 6 weeks?

Marxian Utopia ?

George Mc
George Mc
Aug 23, 2020 6:17 PM
Reply to  crank

Hardly. That would only have amounted to a brief hiatus in business as usual.

Aug 23, 2020 10:05 PM
Reply to  George Mc

Reports in Brazil (where I live) say China has been using HCQ since February. No more pandemic and lockdown there. But Bill Gates, friend of communist dictator Xi Jinping, hater of evil Orange Man, top funder of the corrupt WHO, says HCQ, which has saved millions since 1955 with no ill effects, has dangerous side effects, and that we will need his very effective vaccines instead. Fauci his friend famously warns us not to trust HCQ too. Isn’t that weird? Perhaps it’s because unheard of profits for big pharma will only only possible if off-patent, dirt cheap HCQ remains banned…

Aug 23, 2020 9:26 PM
Reply to  George Mc

She’s a dissappointment.

Aug 23, 2020 9:55 PM
Reply to  George Mc

Lockdown never even arrived in Sweden, which nonetheless had lower death rates than the UK.

Sgt Oddball
Sgt Oddball
Aug 24, 2020 12:46 AM
Reply to  George Mc

Caitlin Jonestown done lost her shit…

…That is *All*.

Aug 23, 2020 2:09 PM

There’s a great song from the 70’s by a band called String Driven Thing called “Circus.” Been thinking of it lately as I watch the neuroses of the locals come to the fore as they wear their masks right out of the door on beautiful sunny days.

The intentional heightened pandemonium of the song as it progresses is apt for what is swirling around us at the moment.

Lyrics and song below:

I was watching the man on the tightrope
He was doing his best to stay up
He was swaying from side to side
And the crowd around him cried

And the nails of the lady beside me
Were digging into my skin
And her breathing was becoming excited
As they let the lions in
She said
Fall, why don’t you fall for me now?
Fall, why don’t you fall for me now?
Fall, why don’t you fall for me now?

With the smell of the beast in my nostrils
And a look of pure fear in my eye
The king of the jungle came forward
And the crowd began to sigh

And the lady who’d been sitting beside me
Was lying upon the ground
And the clown who was riding my cycle
Was going around and around
He said
Fall, why don’t you fall for my now?
Fall, why don’t you fall for me now?
Fall, why don’t you fall for me now?

Come on and take me to the circus
I wanna see the lion
I wanna see the tiger
I wanna see the chimpanzee
The chimpanzee wanna see me … all right
Take me to the circus
Come on and take me to the circus
Come on and take me to the circus
Take me to the circus
Take me to the circus
Come on and take me to the circus
Come on and take me to the circus
Take me to the circus
Take me to the circus
Take me to the circus

You know I’m going home to my Marla
And listen to some String Driven Thing
I’ve had enough freaks in the circus
And none of them are in the ring

You know I’m going home to my Marla
And hang on to her apron strings
I’ve had enough of life in the circus
With animals and everything
She said
Fall, why don’t you fall for me now?
Fall, why don’t you fall for me now?
Fall, why don’t you fall for me now?

Come on and take me to the circus
Come on and take me to the circus

Aug 23, 2020 2:52 PM
Reply to  Maxwell

Thank you for this. I’m ashamed to say I’d never heard of either this band or this song. (Rip Van Winkle’s got nothing on me.)

Aug 23, 2020 2:57 PM
Reply to  Howard

I think for many of us wherever we can create oases of sanity and some sense of “normalcy” that is important. And don’t take no crap from the self-righteous who are ill informed. No matter the case- we gotta keep going.

I’ve had enough freaks in the circus
And none of them are in the ring

Aug 23, 2020 3:27 PM
Reply to  Howard

Same here.

Aug 23, 2020 1:40 PM

If we go with the idea that this wasn’t pre planned then why is this government and team of scientific advisors and medical officers still in jobs.

Professor Ferguson doomsday model was released as a worse case scenario if no lockdown was introduced.

Ferguson’s track record of modelling pandemics have been an absolute shambles.
Analysis of these models have shown they were full of bugs, wrong assumptions and the conclusion that they weren’t fit for purpose.

For Boris and the Tory government to not even bother to peer review this model would be gross incompetence.

And Witty, Vallance and every other scientific and medical adviser in the UK didn’t verify these models? Or did they agree? Again this is gross incompetence.
Why are these people still in jobs and why would any sane person give them a platform.

Witty and Vallance are being allowed to continue to make wild predictions with absolutely no scientific evidence to back up what they’re saying.

And the government and medical advisers refuse to acknowledge the predictions of the lockdowns causing more deaths than Covid and ignore the damage being done to the economy, kids education and the health services.

Hospitals continue to be empty and Nightingales not used.

We are being told restrictions must continue to protect empty hospitals from having patients based on unsubstantiated models from people who have been ludicrously wrong to date.

Plenty of esteemed Professors such as Carl Henegan and Sunetra Gupta have a completely different view than Witty and Vallance.
But they are ignored.

So Boris and every other political leader in the UK don’t you dare tell me your following the science.

Aug 23, 2020 4:15 PM
Reply to  Paul

Boris and favoured experts are scientifically illiterate. That means they treat science as the ancients revered the Oracle of Delphi, as fount of infallible authority and prophecy. They have lost or never understood the endless scepticism which makes science and rational governance possible. Our leaders fail to understand that scientific knowledge is fallible, provisional, and always contestable, which is precisely what allows it to progress. By contrast, dogmatic knowledge is like faith or ideology; Christian, Islamic, communist and fascist beliefs can never be changed, tested or improved. Because government assumes science as dogmatic certainty can justify policy-making (so absolving them of responsibility), it gets hopelessly wrong-footed every time better science appears. During the pandemic, poor or incomplete establishment science treated as dogma and protected from sceptical challenge has led to faulty predictions, absurdly severe lockdown, the demonisation and banning of lifesaving HCQ, the dumb faith in expensive vaccines produced by big pharma, and one of the worst performances in saving lives in the entire world. The UK authorities responsible for all these highly contested decisions are now defending them as right in order to maintain credibility and authority, and failing badly. In sum, you cannot follow ‘the science’, because it has diverse opinions and is by nature “belief in the ignorance of experts” (Richard Feynman). But Boris and green girlfriend, illiterate about science like so many others, clearly prefer to trust incompetent advisors or leftist activist teens like Greta Thunberg and help her panic the world, rather than think critically and sceptically about science.

More on how scientific illiteracy produces fear and loathing, and so traps the naive, here:

Emily Ellen
Emily Ellen
Aug 23, 2020 4:54 PM
Reply to  Paul

We need, preferably over the counter, HCQ and zinc.
The fact that this government has refused to allow its use is little better than mass murder.
There seems a possibility that it is going to finally be used in the USA.
The figures of deaths of countries using HCQ and those not, are absolutely compelling that HCQ works.
It is an outrage that we can’t get it in Britain.

Eyes Open
Eyes Open
Aug 23, 2020 6:01 PM
Reply to  Emily Ellen

The UK Gov spent £20m on hydroxycholoquine, ordered from the United States. I’m guessing this batch is for the super rich and the vaccines are for us.

Aug 24, 2020 5:03 AM
Reply to  Emily Ellen

Nobody needs HCQ.

There’s no evidence of a virus.

Since the mortality rate from country to country is an arbitrary number based on the way governments choose to report deaths, HCQ has nothing to do with the variations.

It may simply be that not putting people on ventilators saves lives.

If people want to mitigate damage from EMF, they should research Melatonin.

If people want to regulate their immune system from overreacting to toxins and prohibit upper respiratory infections, and regulating cytokine release they should research the effects of taking supplemental C, D and Quercetin.

HCQ blocks the hERG channel. It can cause arrhythmia. Azithromyacin blocks the hERG channel. Taking those two medications together is unwarranted and possibly dangerous. I believe the initial researcher who is a fraud and allied with Sarkozy for decades, put those two medications together on purpose. Not to help, but to harm.

And it keeps people enthralled to the idea that doctors are responsible for their health, leading to a loss of empowerment and fear. Leading to vaccinations and mask wearing.

HCQ is a red herring. As long as people argue about how to treat a virus they’re not questioning whether it really exists, or the fact that the tests aren’t connected to any unique properties of the supposed virus. You know. The one that’s never been isolated or purified.

People got better, not because they were given HCQ, but because there is no virus circulating, only the effects of increased radiation from 5g.

So when they weren’t being murdered in hospitals or neglected in nursing homes, they lived.

Aug 23, 2020 9:44 PM
Reply to  Paul

It occurred to me today that slave ships were full of people like us. Is the point of all this drama to keep us slaves looking out the windows to see if we are turning around to head back to our native lands and a life we knew?

Aug 23, 2020 1:37 PM

Good article with a concise distillation of facts regarding the now inbred criminality of the American nation. Ever since WW2 they have increased and sought to justify a course of greed fuelled intimidation worldwide, behaviour exemplifying all the hallmarks of the psychopathic mindset with its complete disregard for human suffering. A nation whose entire economy is controlled by the manufacture of weaponry designed to obliterate, intimidate and subdue any who stand in the way. A nation which can impose sanctions on those it deems necessary and recently resorts to acts of piracy on a country it wishes to enslave with its imperialist agenda.

Edward draws the very apt analogy of a circus wherein the attention of the audience is entertained and, more importantly, distracted, to forever consign any attempt at critical thought and reasoning into the realms of the impossible. This big tented circus is truly the embodiment of the American empire and if it contained animals then those animals could be compared to the subjugated and ruined countries now controlled under the whip of their Uncle Sam ringmaster.

The American people are culpable for this criminality. Since WW2 America is responsible for deaths worldwide of over 15 million people in the name of their malign interpretation of “democracy” and “freedom”. The American people have all bought tickets to this horror show and sadly for them they cannot leave this big top for the show must go on with its perpetual supply of clowns.

Aug 23, 2020 4:34 PM
Reply to  Grafter

Is a Muslim evil because he is Muslim? Is a Jew guilty because of his religious identity? Is someone inferior because of his skin colour? Are all whites racist because of past racism? Are all Iranians guilty of terrorist violence? Of course not, in all cases. We must judge individuals on their behaviour or the content of their character, as Christ, Martin Luther King and many leftists have repeatedly taught us. You betray all that with your hate against people who were born American. What horrible racism. Perhaps you should reflect on the 120m innocent citizens whose lives were ended by their own communist dictatorships over the last century. Countless millions of others must live in fear in case they join them. This unspeakable horror continues in communist China’s hundreds of concentration camps, which currently hold a reported 3m Muslims, Tibetans, and other undesirable minorities. They face torture, rape, murder, organ harvesting, and no release. The USA and other democracies, which gave the world human rights and freedoms, have always fought such evil, never practised it. Trump continues the tradition of opposing totalitarian China and other murderous regimes, but you can only call Americans evil. This moral blindness and insanity is precisely why I left the left, and now believe leftism to be possibly the greatest source of prejudice, hate and ultimately violence in the world today.

Aug 24, 2020 12:00 AM

 Perhaps you should reflect on the 120m innocent citizens whose lives were ended by their own communist dictatorships”

Perhaps you should reflect on the fact that China does not see the world as an object to be raped and exploited for their own benefit. You seem to have a morally defective view of recent American history and its ongoing belligerent behaviour on this small planet we live on which because of their behaviour could extinguish all of our lives in a nuclear holocaust. Left or right makes no difference and as Mr Curtin suggests this three ring circus is full of Republican and Democrat clowns. I do not hate the American people as per your accusation, I do however pity them for their indifference towards the criminal elite which controls them.

Aug 24, 2020 12:42 AM
Reply to  Grafter

Don’t blame me, I voted for Kodos!

Aug 24, 2020 1:15 AM
Reply to  Ort

This is odd. I posted the appropriate “Simpsons” link to the preceding comment, and actually saw the Simpsons’ thumbnail when the comment posted. Now the comment displays a link to the “undercover nurse” video I posted earlier.

I know I saw the Simpsons’ video displaying previously, so I didn’t accidently post the wrong URL. I’m re-posting the Simpsons’ link to see what happens:

Aug 23, 2020 1:31 PM

What really tickles the people’s fancy is when one of the clowns sneaks outside center ring and pisses on the crowd. They can hardly get their hankies out to wipe their face masks clean they’re laughing so hard. Oh those wacky wonderful silly clowns!

Aug 23, 2020 4:52 PM
Reply to  Howard

But Biden is too senile a clown to piss on any crowd. And we Trump supporters are too busy to laugh anyway, as we are busy cheering on Trump the anti-politician in his fight against the corrupt political classes and their corporate and neo-con friends. Sadly, I doubt many leftists have minds open enough to take my blasphemous view seriously or to join us in the great fight to restore democracy by draining the swamp. Making people hate and attack Trump as a greedy capitalist, an evil racist or just a clown is so easy and such a great way to divide popular resistance, and then to rule more effectively and securely. This tactic hides the reality of how globalist elites have corrupted and taken control of so many of our elected politicians, whole parliaments and key institutions like the corporate mass media and ‘neutral’ government advisors. But look how they all fear, hate and want to remove Trump, their alleged puppet!

When War Disappears
When War Disappears
Aug 23, 2020 12:38 PM

Humanity is caught in the death grip of political and corporate leaders and their criminal overlords,
As a deer frozen with fear from oncoming headlights on a road at midnight.
Life for those leaders of the establishment is so comfortable and so luxurious, they feel it is better that everything remains the same for them,
Whilst humanity has to be modified, neutered, lobotomized and culled.
Now the establishment itself has created the situation of an ultimate change.
There have been great people in the world, but even the greatest of them in some way or other, compromise with the establishment.
They all lived in a compromise with the vested interests.
These ‘great’ people are not going to save you!
The society’s whole interest is in how to exploit you, how to enslave you, how to use you in a more efficient way, almost like a machine.
It gives you all the education just for these hidden, secret aims.
Around the world a great rebelliousness is being born against politicians, oligarchs, banksters, technocrats and corporate leaders who are dividing humanity and discriminating between people for total control, power and ownership of the world.
Yet the rebels who are born out of violence prove, in the end, to be anti-rebellious.
The moment they are in power their rebellion disappears.
They become as ugly as the predecessors they have replaced, because through violence you cannot bring flowers of love.
By sowing the seeds of poison you cannot hope that the flowers will be anything other than poison.
Their rebellion was only a reaction of the mind.
They were angry, enraged by all the exploitation, oppression, by all the inhumanity that the establishment had been doing to other human beings.
Out of their anger, out of their violence, out of their rage, they rebelled.
Violence has been the way of life for millennia.
Directly or indirectly we have all lived under violence.
Our armies, our police, our jails, our judges, our wars, our so-called great religions, all have lived in violence.
And violence, reduced to its essentials, is irreverent towards life.
Through violence you cannot achieve a peaceful, silent, loving humanity.
The violence will be in the roots, it will poison your whole superstructure.
Violence can never be a part of the rebellious spirit for the simple reason that violence is the whole past of humanity, and the enlightened rebel wants to discontinue with the past.
The enlightened rebel has to be nonviolent out of sheer necessity.
Unless they are nonviolent, they cannot be the vehicle of a peaceful, warless, classless humanity.
If you sow the seeds of violence, you cannot expect and hope that the flowers will not be affected by violence.
Those flowers will come out of the seeds you have sown.
So each violent revolution has created another violent society, another violent culture.
Out of violence only more violence is born.
When all the revolutions have failed some new door should be opened.
The word for the world at this moment, and for those who are intelligent enough in the present, is ‘enlightened rebellion’.
What is the difference?
Enlightened rebellion is individual action, it has nothing to do with the crowd.
Enlightened rebellion has nothing to do with politics, power, violence.
Enlightened rebellion has something to do with changing your consciousness, your silence, your being.
It is a spiritual metamorphosis.
The real rebel is not a fighter.
Real rebels are individuals of understanding.
They simply grow in intelligence, not in anger, not in rage.
You cannot transform yourself by being angry against your past.
Then the past will continue to dominate you, then the past will remain the center of your being, the past will remain your focus.
You will remain focused in your mind, attached to the past.
You may move to the other extreme, from anger to violence, but still you will be attached to the past.
If you rebel against your own mind it will be a reaction, not a rebellion.
Note the difference.
A reaction is out of anger, a reaction is violent.
In a reaction you become blind with rage.
In a reaction you start moving to the other extreme.
Enlightened rebellion is not a reaction, it is an action.
Enlightened rebellion is not a reaction against the old, against all those who worship and propagate death, against all their lies, control and propaganda.
But it is an action for the new, for all those who celebrate and honour life and rebel for truth.
That is the difference between reaction and action.
Reaction is always determined by your enemy.
Perhaps you have never thought about it, that in reaction the enemy is in a dominating position, they are deciding your action.
What you are going to do, the enemy can decide.
But guns are not needed, bombs are not needed, rioting is not needed, killing is not needed.
What is needed is more alertness, more meditativeness, more love, more consciousness, more gratitude.
Surrounded by all these qualities you are born anew.
We have tried collective efforts and they have failed.
Now let us try individual efforts.
Only a few rebels are needed to create a rebellious society, then others will follow suit, but they will not, on their own, be rebellious.
If the rebellious people create a society, the crowds, just as today they are part of the society, will then become part of the rebellious society.
But they cannot do anything on their own, for the simple reason that it is scary. 
Remember, you can act in two ways, one is reaction, another is response.
Reaction comes out of your past conditionings, it is mechanical.
Response comes out of your presence, awareness, consciousness, it is non-mechanical.
And the ability to respond is one of the greatest principles of growth.
You are not following any order, any commandment, you are simply following your awareness.
Remember, if you want to change the world, you have to change yourself first.
Enlightened rebellion must come to you first.
Only then can you radiate it into others’ hearts.
You must have the flame that you want to see in others’ eyes.
The blind cannot help the blind.
Those who are groping in darkness cannot lead others to light.
Those who are hypocrites, pretenders, cannot help others to be honest.
Those who are not yet themselves, know nothing about themselves, have no idea of their individuality, who are still lost in their personality which is fake and created by the society, cannot help anybody else to attain individuality.
Even with all good intentions, it is simply not possible.
You have to be rebellious, then you can spread rebellion all around you.
If you are on fire, aflame, you can create a wildfire which goes faraway beyond your vision.
But first you have to be aflame.
The blind person leading another blind person, both will fall into the well.
Whatever you want the world to be, you will have to be a model first.
You have to pass through a fire test to prove your philosophy of life by your example.
You cannot just go on arguing about it.
Reasoning and argument will not help, only your experience can give to others the taste of love, of meditation, of silence, of rebelliousness.

Aug 23, 2020 5:28 PM

Interesting comment. Some may not like my methods but I force people to see the truth. This is motivated out of love.

Aug 23, 2020 5:34 PM

Should we accept or condemn those who prefer to trust in peaceful change, regular elections and majority rule, rather than ‘spread rebellion all around’ them? Should we treat normies with different opinions as equals or look down on them as the dumb herd who need our enlightened leadership and salvation? Dictators only do the second, I’d wager.

Aug 23, 2020 12:02 PM

khagan gone
boris piffel donmeh 2much johnson
is missing he is kidnapped
he was taken because of his political beliefs

i am not sure what they are but he seems nice enough
we must help him
help him
free the turkic new york born donmeh khazar khagan

the methods rolling out in aussie,canuckustan and kiwi
are tried and tested methods from old commie russia and smart city china

slow boil frogs

lockstep is the game all in
belarus not quite but maybe soon
beirut big bang now today new masks and lock downs

corrective corrections
it is all a racket know white hats here

gangs counter gangs and pseudo

sometimes mob turf wars but in the main lockstep

divisions dividings spoils

why be a loner when you can be club member

putins desperation to be in not out

iran is in and out of chatham house like a drunken sailor in a dive bar.
mainly arguments over fees and divisions

all these leaders are freaks sexually twisted blackmailed by the beast machine

right left good bad light darkness all satanick dung

all a front for various crime families

Sgt Oddball
Sgt Oddball
Aug 24, 2020 12:52 AM
Reply to  gordan

…Speaking of Khagan, whatever happened to ol’ Vicki Noodleman?…

…- Any sightings of her handing out cookies in Minsk yet?

S Cooper
S Cooper
Aug 23, 2020 11:39 AM

War Is a Racket. Yes it is. To Hell With It!

One who was not a clown.

Aug 23, 2020 5:37 PM
Reply to  S Cooper
S Cooper
S Cooper
Aug 23, 2020 6:54 PM

Do they now?

“Policeman.” Thought no one used that tired cliche any longer.

Aug 23, 2020 7:02 PM

Trump is against war, except in Syria, Iran, Yemen, Ukraine, Venezuela, Somalia, Pakistan, Afghanistan, and a few other places.

Voz 0db
Voz 0db
Aug 23, 2020 10:55 AM

Well… The main problem is that the Herd of modern moron slaves (mms) are so busy with the task of surviving they really don’t know how our wonderful Civilization is organized.

Even when some know, they really understand they can’t do much about it. The main reason for this is that the first opposite Force for Change are the other mms, that really don’t want “any additional troubles” beyond what they already have.

So the majority of mms embraces and enjoys the Circus. They at least can call the clowns (jesters) names, do some pointless marches in the streets, enter some funny fights with another set of mms that Protect the jesters and above…

A long time ago I made a depiction of the Civilization we live in. Those that accept Reality really understand what the MONUMENTAL TASK it is to Change just a tiny piece of this mess.


comment image

Paul Vonharnish
Paul Vonharnish
Aug 23, 2020 3:43 PM
Reply to  Voz 0db

Voz 0db: Good image. Most civilians fail to recognize that the “owners” of the world’s monetary systems always use the same modus. Organizations such as the International Monetary Fund and Bank for International Settlements use financial arbitrage and trade sanctions to insure that no rogue countries can function or exist outside their influence.

Excerpted from: Bank for International Settlements – Wikipedia
“The BIS was established in 1930 by an intergovernmental agreement between Germany, Belgium, France, the United Kingdom, Italy, Japan, the United States and Switzerland.[4] [5] It opened its doors in Basel, Switzerland on 17 May 1930.”
When countries (or States) experience unprecedented drought, famine, civil war, and financial liquidity risks, they are hard pressed to correct the damage as they are now broke or “broker”… Usury banking guarantees that all sub-players will incur debt and be held hostage to the dictates of civilian enslavement and overt fascism.

Aug 23, 2020 5:48 PM
Reply to  Voz 0db

I agree with Ronald Reagan that ‘government is the problem, not the solution’. Maybe you would too. Sadly, we can’t do society without authorities and laws. So should we choose a) government which controls the people (autocracy, the historical norm for 98% of human history) or b) government controlled by the people (democracy, a Western idea only popular very recently)? If I’m not mistaken, the only known peaceful way to empower the people of a nation to choose who governs or to remove failed or fraudulent leaders is through the ballot box. So will you trust and recommend elite rule and accompanying oppression, or majority rule and power to the people? I can agree that democracy has been heavily corrupted and needs to be made great again, hence my support for Trump and not the elite swamp.

Voz 0db
Voz 0db
Aug 23, 2020 6:21 PM

You clearly wish to live under the illusion that mutTrump – a billionaire – cares about “democracy”! After 4 years in the White Horse he has nothing to show for… Except trillions of Wealth Transfer to his Friends and Owners. Enjoy the nickel!

Jan J
Jan J
Aug 23, 2020 7:09 PM
Reply to  Voz 0db

Love it

Aug 23, 2020 9:17 AM

And the curtin dropped and he was exposed— suffering from TDS. Howbout that.

Eyes Open
Eyes Open
Aug 23, 2020 9:11 AM

When the MSM begins its campaign of systematically discrediting anti-lockdown protests by pointing the finger and labelling the protests ‘far-right’ – they won’t be wrong. Some protests *ARE* being led by the Right.

But this is because the unions and the Left in all its forms have refused to participate. The champions of human rights are seemingly OK with technofascism and tyranny.

The Left’s self-indulgent and cowardly absence has amplified the voice of the Right.

Aug 23, 2020 9:16 AM
Reply to  Eyes Open

anybody still supporting this fascist hoax, at this late date, in the face of all evidence, is in fact far-right, whether or not they’re consciously aware of it.

Aug 23, 2020 11:59 AM
Reply to  covidiot

I want to see this issue of “it’s Covid Communism” vs. “the Covid scam is a global fascist take over” explored and settled.
To my reading, the ‘far right’ are better described as ‘third positionists’. Keith Woods’ much watched video here explains this political philosophy as they themselves describe it. If the Left want to portray them as ‘pro-capitalist’, and accuse them of being disengenuous then so be it. They consistently and repeatedly reject Neoliberal, international, rent-seeking, usurous forms of capitalism, and although I am not a signed up member of any political movement, and am not here to defend third positionism, it toasts my nut to keep reading misrepresentations of what they actually say and stand for.
Of note too, is that (again to my reading) many on this relatively small fringe of political opinion have been either silently accepting or are active supporters of the core Covid narrative (i.e. that of a dangerous virus warranting drastic closure of society). Opinion there has been split, perhaps because of the appeal to collectivism which calls to some third positionists’ rejection of individualism. (In this sense, they are akin to most on the Left).
I think this is changing as the Covid narrative starts to completely collapse, and there is clearly more scepticism growing accross the political spectrum.
So how do we describe the authoritarianism of the NewNormalism ?
Who is running the US economy ? Who is running the US political system ? Cui Bono ?
Blackrock, Israel, and a group of internationalist billionaires- would be my answer.
Fascism is essentially a combine of socialistic and capitalistic strategies with the aim of empowering the nation state to its zenith.
Covidism though is global. It is not about national power. Clearly it is not socialism as most people understand that word, yet those who point out the preponderance of certain characters with internationalism (be that capitalistic or communistic) are demonised and their arguments ignored. The cirus is national to the naive public, but it is clear to the reader that the acts therein are part of something buch bigger.
Within these events, some invoke the sense of larceny for the super rich, or point to the Marxist past of characters like Dr. Tedros, or the rise of Neo-marxist street violence in NW USA. These are not ‘far right’.
So what is New Normal ? A ‘fourth position’ ? – a collectivist, authoritarian, globalist death cult ? Who wants us Dead ? WHO wants us dead.

Germs Bond
Germs Bond
Aug 23, 2020 4:56 PM
Reply to  covidiot

I think Covidians are strongly authoritarian. I don’t know if they are right wing but suspect you are correct. What would an election look like today? Or in two years time? It might return an anti-Covid-Hysteria parliament which would be dangerous to the health of the nation. An election is not permissible. Elections have already been banned all over the Earth. I consider that completely nuts. Could the abolishment of elections be the real reason for this quarantine of the healthy? Could the Global Reset (as seen in MSM outlets) be a red herring?The 5th of November will offer a clue.

Aug 23, 2020 6:19 PM
Reply to  Germs Bond

‘An anti-Covid-Hysteria parliament which would be dangerous to the health of the nation.’

Could you explain this: Public health? political health?

From what I see, you are correct about some elections being suspended e.g. in the UK and some leaders haveunilaterally extended their terms (Ardern in NZ for example).

Aug 23, 2020 12:18 PM
Reply to  Eyes Open

This is a psychological operation to slide the population into fascism by redefining the word.

Any challenge to the Neoliberal Elite since 2016 has been labeled “far right” or “white supremacist”, even as latter transcended 1930s Corporatism, the very definition of fascism.

This neuters the people: how can you call your government fascist if, by the very act of doing so, you become a fascist and thus outside the pale?

Whether or not you were in the Court of the Orange King, simply citing the Constitution has been enough to cancel you as “fascist” or, if you are a lefty, “a red brownshirt”.

Is the left responsible for neutering politics by maiming the language? Partly. It’s also been the victim, however, and remains cowed and silent, frightened of being labelled, just as the UK Labour Party rolled over and let outsiders label who was and was not beyond the pale.

Eyes Open
Eyes Open
Aug 23, 2020 12:24 PM
Reply to  Moneycircus

100% correct.

Sgt Oddball
Sgt Oddball
Aug 24, 2020 12:56 AM
Reply to  Moneycircus

Any challenge to the Neoliberal Elite since 2016 has been labeled “far right” or “white supremacist”, even as latter transcended 1930s Corporatism, the very definition of fascism.

Psychopathy 101: – Psychopaths gonna *project*… – ‘specially onto their victims…

John Ervin
John Ervin
Aug 24, 2020 12:21 PM
Reply to  Moneycircus

What I’ve seen in my whole lifetime looking at national politics (USA) is “battered democrat syndrome”: infiltrate the Dems up the wazoo then tell them it’s all their fault for letting it happen.

Problem is, we’ve never developed any real “immune system” that can defend us from such a simple trick. Simple though “well-financed”.

Aug 23, 2020 2:17 PM
Reply to  Eyes Open

Reading the exchanges on Twitter regarding Caitlin Johnstone’s non-position, I think again that there is something fundamental about Leftist thinking which struggles to comprehend this moment we are in.
A Leftwing friend with whom I discussed the Covid situation some months back, could not at that time see the events as anything other than as described in the media or in Leftwing outlets. The global nature of the governmental response for him precluded any possibility that there might be ulterior motives or deception at play. NB Cuba, Iran, Venezuala, China, Russia have all been understood for many years as rivals to the US dominated empire and yet they all joined in with the charade of Covid 19. Lefties struggle to fathom this disconnect, as they have been steeped in understanding the world order as ‘US domination’ (as described by Curtin here) pitched against the freedom fight of plucky renegades. Truth is more complex I would argue.
There are only two routes to a clear conception of 2020. One is to simply abandon political alignment and look at the facts of the virus and the lockdowns, then try to build a political model that can account for those facts.
The second is to start from an conception of globalised power – and one that is not exclusively US centred, but transcends borders and political zones. (Note that the Wuhan lab was doing off shored research for US bioweapons complex !). Lefties though have a kind of heightened awareness to read any such concept as the rhetoric of their arch enemies. Any mention of ‘globalists’ to most of them it is a Rightwing dog whistle that is more powerful than the cognitive dissonance produced in them by the multilpe train wreck that is unfolding around us.
Achilles Heel.

Eyes Open
Eyes Open
Aug 23, 2020 5:38 PM
Reply to  crank

I’m a lifelong ‘leftie’ and I can clearly see what’s happening – with horror. How others can’t see it, is mind boggling to me.

I suspect Caitlin Johnstone is a State funded, controlled opposition shill. There are plenty of others no doubt.

Aug 23, 2020 8:08 PM
Reply to  Eyes Open

I’m a lifelong ‘leftie’ and I can clearly see what’s happening – with horror. How others can’t see it, is mind boggling to me.

What can I say? Take the red pill and wake up. Things will then make sense.

Aug 23, 2020 10:38 PM
Reply to  Eyes Open

> I suspect Caitlin Johnstone is a State funded, controlled opposition shill. There are plenty of others no doubt.

One gets the *strangest* feeling reading the comments on “her” site..
That, and “her” recent “it’s just all so confusing!” vibe re: the Dreaded
Pathogen™ made me stop reading there on a regular basis.

Sgt Oddball
Sgt Oddball
Aug 24, 2020 12:58 AM
Reply to  Eyes Open

Caitlin *Jonestown*.

…- FIFY.

Eyes Open
Eyes Open
Aug 24, 2020 1:24 AM
Reply to  Sgt Oddball

I copied the spelling from ‘Crank’ who I was replying to.

Aug 24, 2020 4:50 AM
Reply to  crank

Yes. There are no countries or borders, or even sovereignty.

They exist in theory, but in practice their existence has little meaning.

The illusion is what’s been fostered. The idea of nation states are used to pit one group of people against another in wars, the same way the voters are divided against each other in each country, as are the covid skeptics against the covid believers.

The same way, in ancient societies, religion was used to send armies to war.

The wars are merely tools for eradication of human life, to disguise land and capital transactions.

When “New World Order“ was proclaimed out loud in speeches by presidents and politicians it had already occurred with the formation of the UN.

There’s no need for a one world government if there’s already a global governance system in place through the IMF, IBS, World Bank, Central Banks, Chatham House, CFR, Trilateral Commission, WEF, UN, WHO, etc.

People have difficulty recognizing the world in anything other than nation state terms, but only because they view the world through a skewed cultural and nationalistic lens from rewritten history, poor education and saturation of the media with propaganda.

Aug 23, 2020 8:44 AM

And of course the Palestinians are left to suffer and die as Israel is supported in its despotic policies in the Middle East.

This is a weak addendum thown in for the sake of inclusion.
Curtin is like so many here, quite rightly getting us to think about the foreign policy of the USA, but studiously avoiding the elephant in the room. The political Left’s pathological refusal to honestly consider the true relationship between Israel and the US (or to consider the ethno-religious-supremacists within US power circles and their curation of that relationship) is just one more example of ring mastering. The deranged ignorance of liberals and the duplicity of ‘Conservatives’ are two anothers.
Who owns the circus though?
I recommend this long article (below) asking us to follow the money trails which lead back to roots of the atrocities which Edward writes about here. These are monumental times, and we need the full context :

Emily Ellen
Emily Ellen
Aug 23, 2020 10:18 AM
Reply to  crank

The USA billionaires of which there are some 600 apparently, are at last count and that is quite a while ago – 565 billion dollars richer from the plandemic.
The US working and middle classes are losing jobs by the million and are now facing real struggle, even poverty and hunger.
Follow the money?
Those figures tell all.
Business Insider puts it another 100 billion more……

Eyes Open
Eyes Open
Aug 23, 2020 10:38 AM
Reply to  Emily Ellen

It would be handy if Off-Guardian could publish a piece about this, because it reveals the true purpose of ‘coronavirus’.

Sgt Oddball
Sgt Oddball
Aug 23, 2020 11:07 PM
Reply to  Eyes Open

Agreed, Eyes Open. I would *very much* like to see the Admins tackle that as well.

This seminal paper from 2011 provides an excellent jumping-off point:…

…Identify the (corporate/institutional) shareholders of the components of the ‘super-connected entity’ described in the paper. Then continue to follow the money until you wind up at the *individual* shareholders. – They’re your ultimate ‘owner class’, and to a man and woman, the actual perps behind the whole sordid caper.

Aug 23, 2020 10:53 AM
Reply to  crank

I have read that Tony Hall article and I found it a very useful aid to understanding the history and structure of what is going on. No lizards, no 5g, just a very detailed expose of how ‘the money’ works. Conspiracy facts not theory!

I would recommend taking the time to read it. If you don’t like the Unz Review, it’s also on the American Herald Tribune site:

Aug 23, 2020 10:42 PM
Reply to  MiriamW

> I have read that Tony Hall article

I thought it was way, way, way too long, and unfocused.

“Look over there!”

/ pass

Jan J
Jan J
Aug 23, 2020 7:01 AM

Nice article. “Representative” democracy is how the real elite can continue to call the shots behind the scenes – it’s impossible to corrupt a whole nation, but it’s quite easy to bribe, coerce, intimidate, extort and control a few power-hungry “representatives” in parliament. It is the same in any western country, but the clown-show is more pronounced in the US I suppose.

In most countries, the political system has stayed unchanged for literally centuries. Why is that? I can imagine in the early days, it was quite cumbersome to send the entire district to parliament. Sending a representative makes logistical sense in the age of the horse and carriage. Of course, it’s also much easier to bribe, coerce, intimidate, extort and control that ambitious and power-hungry “representative”. Knowing that, we should start campaigning for a new DIRECT democratic system.

Now, in the digital age, it does not make any sense to have political parties and politicians. I do all my banking online, do my taxes online etc etc. Cryptocurrencies have revealed the power of blockchain as an “audit” trail. An AI-assistant could vote for me in a citizens parliament according to my political preferences when I’m busy at work, goofing around or whatever. The technology is now in place to allow for digital direct democracy. We don’t need these parasites of the political class to “represent” us anymore!

About now the usual objections come in: Oh, but “digital can be manipulated” and bla bla bla. I suppose unsigned pieces of paper (ballots) in large boxes has been proven to be a much more “robust” system, right? It’s equally open to manipulation. Besides, the true corruption often happens after the vote (remember those representatives are easy to control). What matters to the integrity of the outcome is the PROCESS and security around the process. Besides, if the citizens were actually voting on issues and submitting policy themselves, the need for ONE huge voting event (parliament, president, whatever) disappears, because you are voting continuously on many smaller issues, and the risk of a “great heist” or “stealing the election” type of event disappears.

Aug 23, 2020 7:15 AM
Reply to  Jan J

Fascinating that all the talk about AI and big data does not touch on democracy, isn’t it. It’s as if Information Technology is purely a way for vested interests to control the people.

It’s used to tell us what to think – when it could just as easily be used to ask us what we think.

Why are Digital IDs being discussed as a way to grant us temporary rights to participate in society on pain of exclusion and subject to revocation (if we don’t submit to this or that) — instead of Digital IDs as a right to decide what goes or doesn’t go?

The Internet makes direct democracy possible. As you say, representative democracy, deputing others to act as tribunes, has been around for centuries.

I worked on a project using algorithms borrowed from cryptocurrency that would translate the popular will into decisions on specific policies. There is always a need to balance the will with wisdom and experience – that’s what the upper chamber is for but we have the technology to dispense with corrupt placement, political parties and lobbyists.

It’s even possible to have second and third rounds of consultation – sending a proposal back to the people to think it over – as a positive means to refine and perfect decisions rather than as a negative tactic to delay, stall and squelch initiatives as happens with the consultation process nowadays.

Jan J
Jan J
Aug 23, 2020 8:21 AM
Reply to  Moneycircus

Yes, it’s strange how technology accelerates at a rapid pace, but our system of governance established centuries ago, in the age of horse and carriage, is already 100% perfect apparently – nothing to see or improve on here, move along! Do your democratic “duty” and vote for the next clown that’s in our pockets already 😉

Interesting to hear about your project. Technology can liberate or enslave – we’re on the “enslave” path here right now. I don’t think technology is fundamentally “bad” or “good”, again it depends on the people and forces behind it. Technology could as you say be used in a positive way to ensure that the will of the people is indeed being heard, and that decisions that do not have support are not enacted. That’s what democracy is all about right? (at least in theory).

Aug 23, 2020 9:41 AM
Reply to  Moneycircus

Information Technology is purely a way for vested interests to control the people.

Kaczynski was right in his analysis (if not in his actions).

John Do-Nut
John Do-Nut
Aug 23, 2020 12:49 PM
Reply to  Moneycircus

There is no Democracy. It is but an illusion.

Data harvesting for AI purposes will be used for evil, you can guarantee it.
When the machine finally awakes we will see a new modern form of Fascism. But we won’t be told by allowing our every stroke of the keyboard, our thoughts, our images, our voices, and the digital collection of every piece of our daily lives, that we have unknowingly, and unwittingly, played a part in our own imprisonment.

Aug 23, 2020 1:13 PM
Reply to  John Do-Nut

“Data harvesting for AI purposes will be used for evil, you can guarantee it.”

IBM made the Third Reich possible. How did it happen that Microsoft, a company born out of IBM, is in turn giving birth to a new generation of the same technology: Hollerith punch cards, recording all a person’s ethnic, medical, labour and social data.

A portable score of one’s social credit, value or worth. Perhaps linked to a digital wallet, providing the ability to control what you buy, as already happens in China.

comment image

comment image

The Nazi Party: IBM & “Death’s Calculator” by Edwin Black

Aug 23, 2020 4:41 PM
Reply to  Moneycircus

To clarify, I’m not saying something silly like these companies are uniquely evil (clearly technology firms are aware of that ethical risk, or they’d never have a motto ‘don’t be evil’ in the first place, and they wouldn’t feel the need to retire such a motto, as Google did). I have family members who’ve worked for two of these three companies.

It does illustrate, however, the likelihood of technology to veer toward evil, not simply the possibility. It’s not just a matter of “business”: inanimate money working with both sides. It is truly remarkable that the same companies that saw fit to enable the worst aspects of the Third Reich are at it again.

Sgt Oddball
Sgt Oddball
Aug 24, 2020 1:14 AM
Reply to  Moneycircus

You might find Lutz Dammbeck’s documentary ‘The Net’ insightful, Moneycircus…

…- Details the origins and history of the computer/information revolution, with particular respect to the intersection of cybernetics with behavioural psychology, and the resulting birth and rise of ‘biopolitics’.

(Mixed english and german, with english subtitles.)

Sgt Oddball
Sgt Oddball
Aug 24, 2020 1:17 AM
Reply to  Sgt Oddball

…crank, you might wanna check this out too, considering your Ted Kaczynski reference, up-thread…

Aug 23, 2020 10:01 AM
Reply to  Jan J

Good to see people raising this idea.
A genuine alternative. It at least appears achievable.
Robert Anton Wilson wrote about it twenty years ago.
I’ve done some thinking on it myself in recent years.
A mass society will still need some kind of structure to implement decisions made in any participatory process. That is a tricky element. The state is a monopoly of violence which is maintained by paid enforcers. How can a participatory system control the controllers ?
Incumbancy is the issue. We need structures without incumbants : i.e. ones that form for the duration of the decision then fade to nothing.
How would a polity be demarkated ? States need to be protected, unless this is to be a global system of governance. Governments are seen and see themselves first and foremost as defenders of the realm. Hard to perform this role without office holders.
Finally, the media and the information war would become an even greater focus of attention if ordinary people actually had power and made decisions based upon that information. Maybe that would be a good thing ? Whoever controlled the internet would effectively control all decisions in such a participatory system, and things don’t look too good on that front at the moment.

Aug 23, 2020 11:19 AM
Reply to  crank

‘Going Direct’ is the name bankers have given to their plan to abolish cash under the cover of Event Covid. It’s time to steal their slogan and use it to hammer the whole plan to use the internet to repress the people.

Yes, we want to ‘go direct’ but we’ll keep untrackable money, thank you. Instead we’ll take direct democracy.

Google’s and Facebook’s manipulation of the internet is allowed to continue by the present incumbents… A direct democracy system would not tolerate that. It would be addressed.. unlike in the present where Robert Epstein, senior research psychologist at the American Institute for Behavioral Research and Technology, have clear evidence of manipulation only for his wife to die in a mysterious car crash (sure a crash is a crash but given the import of Epstein’s allegations and the timing I’m not buying it.)

Jan J
Jan J
Aug 23, 2020 6:56 PM
Reply to  crank

You don’t have to discard the entire governance model to make this work – you just replace the representatives in the legislative assembly (parliament) with a direct link to the people, you can keep the bureacracy to actually effectuate everything. In a representative democracy, government is usually formed by the dominant political party/ a majority coalition – however, what does that “goverment” actually consist of? 20-ish ministers and they closest aides is the political part of it, and the rest (99.99%) is the good ol’ bureacracy effectuating everything – regardless of who is in power. The bureacracy stays relatively constant between governments, it could be that way in a direct democracy as well, only that they answer to the people not to some incompetent fool like BOJO the clown and there would be no elected government per se (it would be redundant) Obviously you would need to develop mechanisms that ensure that the bureacracy does what it’s told (but that works reasonably well today, so no need to reinvent the wheel). The risk of bureacracy not obeying a political governance is also a risk inherent in any form of representative democracy, but this strikes me as a rare problem in the west today.

Aug 23, 2020 7:10 PM
Reply to  Jan J

good ol’ bureacracy effectuating everything – regardless of who is in power.

This is often seen as the ‘permanent government’ though. Political influence of vested interests is not just aimed at elected representatives, it is rife throughout bureaucracy too. One thing that strong government can do is (potentially) act as a counterbalance to this incumbent bureaucratic power [Seen ‘A Very British Coup‘ ?] It rarely happens of course, but one can see the attraction of leadership when there is a hive of civil servants who have been embedded in the state for generations and regard themselves as society’s true managers.
I like the idea of direct democracy through the internet. It could be ultimately the invention’s greatest contribution and obvious destiny. It needs more work though in my opinion.

Jan J
Jan J
Aug 23, 2020 9:46 PM
Reply to  crank

Good points! however, it’s ultimately the legislative assembly that make the laws and determine the national budget, and I believe it is here the most sinister subversion of democracy happens and where the representatives simply are often not voting in the interest of their constituency, but in the interest of powerful interest groups – take as the prime example the US where politicians are practically bought by special interests more or less openly.

I have no immediate solutions to the problems of the entrenchment and corruption of the bureacracy, you bring up some very valid points, but again as an “all else equal” argument, it is really a separate problem from my initial proposal that actually needs to be seen independently of parliamentary approach to democracy.

To the extent politicians could clean up incumbent bureacracies, so could other forces. What those forces could be I really don’t know, but that’s the beauty of just theorizing… 🙂

Agree that D(irect) (D)igital (D)emocracy needs more work, but it’s fundamentally a good and positive idea, and campaigning for it to the point that It would be actually considered would really force the hand of the existing “democratic” systems – I have a feeling the political class and their “owners” don’t like the idea much.

Sgt Oddball
Sgt Oddball
Aug 24, 2020 12:05 AM
Reply to  Jan J

For the bureaucrats: – short-arsed term limits and *instant* recall for all…

…- Even better, a rotating, straw poll system like jury duty, again with instant recall for transgressors/fuck-ups. – Make civic service a personal duty and a public honour… – Teach that to the kids in school, as well.

Aug 23, 2020 7:13 PM
Reply to  Jan J

As an example of this, several people consider Mark Sedwill to be effectively running the UK at the moment.

Sgt Oddball
Sgt Oddball
Aug 23, 2020 11:53 PM
Reply to  Jan J

“…you just replace the representatives in the legislative assembly (parliament) with a direct link to the people,…”

…A blockchain-based publishing platform like Steemit, perhaps in a more Wiki-like collaborative authoring/editing format, combined with a Github/Subversion style repository/version control framework would achieve that.

‘We the Peeps’ would be able to cooperatively draft our own legislation, with both individual contributions and the overall draft-in-progress being blockchain-authenticated at all stages. Individual edits would be attributable and conflicting edits resolved via version control, and constraints could be placed curtailing semantic complexity/legalese through community rules/forum chat discussion a-la Wikipedia.

Further, as Moneycircus pointed out to you in a comment furter up the thread;

It’s even possible to have second and third rounds of consultation – sending a proposal back to the people to think it over – as a positive means to refine and perfect decisions…

So the draft-in-progress could be discussed, voted on and further refined, again via forum chat, etc.

Once a ‘final draft’ has been arrived at it could be submitted to communal vote, preferably blockchain- or other strong encryption-authenticated.

The best part is that all such legislation would be necessarily *provisional*, even after voting. – It could subsequently be ammended, edited, folded, stapled, mutilated, deleted, or buried in soft peat for six months and recycled as firelighters, or whatever… And *all* by common and collaborative consent.

Aug 24, 2020 8:04 AM
Reply to  Sgt Oddball

Do you know of a place where these ideas are being discussed in depth ?
On the point of sortition or straw poll/ jury service, I read ‘In The Name of The People’ by Ivo Moseley, which makes the case that modern ideas of ‘democracy’ (through election) were regarded as a route to tyranny by just about everyone from the Greeks to the early Victorians. Real democracy was always understood as involving the drawing of lots.
Somehow these things get lost.
Thanks also for the ‘Net’ doc link. I watched that some years back, yes, but could well watch it again.

dr death
dr death
Aug 23, 2020 2:44 PM
Reply to  Jan J

oh you are going to get your direct digital democracy, but you wont like it.

Jan J
Jan J
Aug 23, 2020 7:15 PM
Reply to  dr death

If I get it in the format I described, I’m pretty sure I will prefer it over the Pluto-oligarchical corrupt faux-democracy we have today! but feel free to elaborate.

Aug 23, 2020 6:59 AM

Predictable, I know, but couldn’t help.

Aug 23, 2020 6:00 AM

“The Umbrella People are the moguls who own the showtime studios – some call them the secret government, the deep-state, or the power elite”

I call them Colluding Class because they collude to steal assets from people (like the Kohl-Regime did from me) and carve out new wars by never ever resolving conflicts but nurturing them to simmer.

Jerry Alatalo
Jerry Alatalo
Aug 23, 2020 5:40 AM

Perhaps without specifically asserting it, the great Edward Curtin’s message is: “Humanity has endured more than enough unnecessary, tragic wars, and the time has long past when humanity finally stops the world’s war criminals and ended criminal wars of aggression forever..Emphasis on forever..”


Sgt Oddball
Sgt Oddball
Aug 24, 2020 12:14 AM
Reply to  Jerry Alatalo

“The issue which has swept down the centuries and which will have to be fought sooner or later is the people versus the banks.”

John Dalberg, Lord Acton.