467

WATCH: Is the UK heading toward medical martial law?

We are hearing frequent calls for the UK's coronavirus "pandemic" response to become a military operation

Kit Knightly

On the 28th September Tobias Ellwood, Tory MP for Bournemouth East, stood up in Parliament and suggested that the British Army and the Ministry of Defense be in charge of distributing and administering “millions of doses” of the Sars-Cov-2 vaccines, as well as issuing “vaccination certificates” which will “allow travel”.

And that’s just the highlights, there’s a lot more vaguely sinister language, camouflaged in his rather drab monotone voice. (You can watch the whole speech here, go to 20:24).

This is a concerning development, one very much worth keeping an eye on. The BBC don’t think so, of course, because the call for what would easily amount to medical martial law didn’t even make it into their “Today in Parliament” programme.

This is not new behaviour for Ellwood. He has always been a consistent voice for use of the military in response to the “pandemic”. On the 18th of September he requested the Prime Minister make “greater use of our fine armed forces”.

He specifically mentions “managing the narrative”, which is no surprise considering his role as a former Army officer, a current reserves officer, and his known affiliation with the 77th Brigade. For those who don’t know: The 77th is the British army’s team of “facebook warriors”. An information warfare unit whose job is to “counter misinformation”, “manage the narrative” and generally corral and control the internet conversation.

That’s not a “conspiracy theory”, their existence is readily acknowledged by both the government and the mainstream media. Considering they’re currently employed “countering covid misinformation“, they will likely be in the comments of this post (Hi guys!).

Other countries around the world have already moved on to this “war footing”, and the UK is likely not far behind.

Thanks for reading...

You can help us keep doing what we do. Every little helps and is hugely appreciated.

For other ways to donate, including direct-transfer bank details click HERE.

Subscribe
Notify of
guest

467 Comments
newest
oldest most voted
Inline Feedbacks
View all comments
John Goss
John Goss
Oct 8, 2020 3:15 PM

I just watched a video of the Air Force knocking on people’s doors in Handsworth, Birmingham, trying to get them to do a “free-test”. Next week it will be jackboots and forced vaccination.

richard
richard
Oct 5, 2020 3:00 PM

Vid from Spiro on PCR “tests” and the implications for humanity.

https://youtu.be/Ljxah4NrYKU

Coram Deo
Coram Deo
Oct 5, 2020 12:07 PM

WALES: VACANCY: SENIOR PROJECT MANAGER
We are looking for an exceptional, enthusiastic and highly motivated individual to Programme Manage the COVID Mass Vaccination Programme for Cwm Taf Morgannwg University Health Board. Working with a range of partners, the key aim of the programme is to vaccinate the entire population of Cwm Taf Morgannwg including all its health care workers as a key part of our response to the COVID pandemic. The programme will encompass the development and delivery of all aspects of a Mass Vaccination plan including: the patient journey, assets and infrastructure, workforce, vaccination programme, ICT, communication and engagement, all controlled within a robust programme management governance structure.
https://www.jobs.nhs.uk/xi/vacancy/916207927

Coram Deo
Coram Deo
Oct 5, 2020 12:06 PM

***PLANDEMIC UNMASKED: CRIMES AGAINST HUMANITY
video – 49 mins
Through an international lawyer’s network, which is growing larger by the day, the German group of attorneys provides to all of their colleagues and all other countries – free of charge – all relevant information, including expert opinions and testimonies of experts showing that the PCR test cannot detect infections. And they also provide them with all relevant information as to how they can prepare and bundle the claims for damages for their clients so that they too can assert their clients claims for damages – either in their home countries law courts or within the framework of the class action explained above. These scandalous Corona-facts, gathered mostly by the Corona Committee and summarized above are the very same facts that will soon be proven to be true, either in one court of law or in many courts of law all over the world. These are the facts that will pull the masks off the faces of all those responsible for these crimes. To the politicians who believe those corrupt people, these facts are hereby offered as a lifeline that can help you readjust your course of action , and start the long overdue public scientific discussion, and not go down with those charlatans and criminals.     Dr Reiner Fuellmich
Thus saith the Lord, Let my people go, that they may serve me.  Exodus 8:1-2
https://brandnewtube.com/watch/crimes-against-humanity_jIEzyvxLUfKKocD.html

Waldorf
Waldorf
Oct 5, 2020 11:37 AM

https://www.rt.com/uk/502544-glitch-surge-covid19-cases-fixed/
Following the numbers, and then screwing them up…

sam2
sam2
Oct 5, 2020 12:53 AM

https://www.telegraph.co.uk/news/2020/03/20/not-spy-tory-mp-tobias-ellwood-dismisses-claim-monitored-trump/
‘I’m not a spy’: Tory MP Tobias Ellwood dismisses claim he monitored Trump adviser as ‘uncredible’Ellwood tells his account of 2016 campaign meetings on the Crossfire podcast

abinico warez
abinico warez
Oct 4, 2020 10:34 PM

Be warned – enter a state of medical martial law and there will be no end to that tyranny.

Truth Shines
Truth Shines
Oct 4, 2020 3:01 PM

People are waiting for some saviour to come and deliver them from all this misery.
The saviour is not going to come.
You have to be the saviour yourself. 
 If we really want to solve all our global problems, we will have to go to their roots, to their very roots.
Politicians have been befooling you.
Politicians are diverting the attention and energy of the people in the wrong directions.
They have managed the whole strategy in such a way that you never become aware what is happening.
Politicians give you all kinds of fake protections, insurances.
They go on telling you, “Trust us and we will protect you.
We are your guardians, your guides, your friends, your saviours.”
Yet politicians and MSM news media live in constant paranoia that if anybody should find some truth that goes against their false, fear-fuelled virus narratives, then what is going to happen to all their other lies that they continuously go on propagating?
Will their whole house of cards collapse?
By using such powerful media propaganda machinery to maintain total narrative control, is it not suprising that the majority of people believe all the politicians and their lies, and get taken in hook, line and sinker!
Lies which are ninety-nine percent myth, invented, propagated to support the false power elites’ global structure narrative and control agendas.
We are living in the greatest prison system the world has ever known, where you enter alive and leave only when you are dead.
This they call freedom.
This they call democracy.
But in actual practice this is slavery, pure spiritual slavery.
I do not see democracy as the freedom to choose between the politicians.
To me, democracy means there are no longer any politicians around.
You individually choose somebody you feel is the right person, who is not belonging to any political party, there are no longer political parties.
In a real democracy, political parties cannot exist, there is no reason why they should exist.
People are intelligent enough to choose on their own.
The politician need no longer go on deceiving and lying to the people.
Politicians only want to exploit you, to oppress you.
In a real democracy what is the need of political parties, of politicians?
The real need is to make people more alert, more intelligent, so they can choose individually, and not be impressed by party propaganda.
A real democracy will choose only the wise people.
They are all around.
But remember, a person of wisdom is not going to beg you for a vote.
They are not going to kiss your children and shake hands with you.
The wise person is not interested, in fact, they will not be inclined to be dragged into this mess.
You will have to persuade them.
The whole scene changes, not the politician persuading you, but you persuading someone to represent you.
This way, more fresh intelligent blood will be coming into the government.  
Whenever great problems arise, it is the time for a leap forward.
Human consciousness takes a jump when such great problems surround you.
They compel you to think and reflect, to struggle and to stake your very life.
Only when it is really a question of life and death does consciousness prepare itself for a great leap.
The time has come to face the fact, with these existing politicians, we are on the very verge of a total global war which will destroy everybody.
What is intelligence?
It is a state far beyond the mind and its limits.
Intelligence is not of the mind, intelligence is one of the qualities of your being.
But mind is being used as a vehicle for it, hence the confusion.
People think intelligence is of the mind, it comes through the mind.
Mind is the instrument for its expression.
But mind itself is only a bio-computer.
It has a memory system just as any computer has, you feed the memory system and the mind keeps the memory.
But memory is not intelligence.
Intelligence is the clear insight into things about which you don’t have any information.
What is needed is for the Western ego to be shattered completely, only then perhaps we may start looking at our intelligence behind the mind.
If you are in the mind it means you are not conscious.
If you are unconscious you cannot be complete in anything.
You are not integrated.
You may appear to be sophisticated, educated, logical, but you are not wise, not really intelligent.
Just conditioned, obedient, compliant and fearful.
Intellectuals are not the real intelligent people.
That’s what all your universities and all your educational systems are doing, they are simply feeding your memory with more and more information, and whatever is known to your memory system, you will answer immediately.
That answer does not prove that you are intelligent!
Western behavioural psychologists direct politicians to make the ego/mind mechanism of the masses fully compliant, to fully enslave them.
Yet this is a psychology of the false, rooted in the false, supporting the false.
This false hypnotic sleep is like a tranquilizer, it is very consoling, comforting, cozy, secure, safe.
That is comforting, secure and safe for the politicians, to know that we are all fully asleep, compliant, enslaved!
If we want to change the whole world.
We will need to change ourselves.
We cannot change anything unless we go through the change simultaneously.
The real disturbance is within you.
That disturbance is mind!
Great courage is needed to meditate, courage to drop all the investments.
Great intelligence is needed.
Truth needs no defense, it is self-evident.
It needs no propaganda.
Lies need to be defended, lies need to be propagated, but not truth.
Truth shines almost like a sunrise, you don’t have to declare it.

Tony Clay
Tony Clay
Nov 3, 2021 10:19 AM
Reply to  Truth Shines

Great stuff, Thanks.

RUN!NOW
RUN!NOW
Oct 4, 2020 12:08 PM

tik tok tik tok
time is almost up …
BUT still you pretend …still you use their realm to react use their words to reply
use their rules to complain ..
You absolute fools! you will still be surprised when they are at your door .
When ? when will be enough ..?
PREPARE !

geoff
geoff
Oct 4, 2020 11:33 AM

Hi everyone,
I would like to draw your attention to the Covert Human Intelligence Sources (Criminal Conduct) Bill, currently submitted to parliament. It has already had its first reading. The second reading will be tomorrow, Monday 5th October. All final stages are scheduled for 15th October. I am not a lawyer and do not have legal expertise. However, as a layperson, the bill seems extremely concerning. By my reading, it appears to put already powerful sectors of UK society outside the rule of law. I’d be interested in hearing your comments, especially from anyone who has relevant expertise.

The bill can be found here: https://services.parliament.uk/Bills/2019-21/coverthumanintelligencesourcescriminalconduct.html

On this page, the bill is summarised as:
“Summary of the Covert Human Intelligence Sources (Criminal Conduct) Bill 2019-21
“A Bill to make provision for, and in connection with, the authorisation of criminal conduct in the course of, or otherwise in connection with, the conduct of covert human intelligence sources.”
[emphasis mine]
Inspection of the Bill reveals that it is not restricted to intelligence agencies, but rather includes a list of Relevant Authorities. The list is rather long:

Police forces etc
A1 Any police force.
B1 The National Crime Agency.
C1 The Serious Fraud Office.

The intelligence services
D1 Any of the intelligence services.

The armed forces
E1 Any of Her Majesty’s forces.

Revenue and Customs
F1 Her Majesty’s Revenue and Customs.

Government departments
G1 The Department of Health and Social Care.
H1 The Home Office.
I1 The Ministry of Justice.

Other bodies
J1 The Competition and Markets Authority.
K1 The Environment Agency.
L1 The Financial Conduct Authority.
M1 The Food Standards Agency.
N1 The Gambling Commission.”

There doesn’t appear to be any restriction on the type of crimes these bodies will be permitted to commit. There is mention of the Human Rights Act 1998, but the checks and balances appear weak:
“Subsection (6) is without prejudice to the need to take into account
other matters so far as they are relevant (for example, the requirements of the Human Rights Act 1998).”

NobodyUKnow
NobodyUKnow
Oct 4, 2020 5:15 PM
Reply to  geoff

Just because they make tyranny legal doesn’t make it legal.

If whatever they do offends natural law, then it’s not just. Or legal in the mind of any reasonable person as to what is just, or legal.

Fact Checker
Fact Checker
Oct 4, 2020 9:33 PM
Reply to  geoff

Every governmental apparatus is being fully reconfigured to do harm, only harm and maximum harm. This bill is simply to prevent any “white hats” that may remain scattered throughout government from interfering with the wanton kill-and-maim operations that constitute the sole function of “government” from here on out.

p_davey
p_davey
Oct 4, 2020 4:12 AM

Driving the propaganda is the faulty PCR testing and the manipulative changes to the way that NHS England is collating further statistics wrt hospital admissions.
A recent review from a retired former government scientist in the following link.

https://principia-scientific.com/scoop-govt-scientist-exposes-covid19-hospital-beds-scam/

JudyJ
JudyJ
Oct 4, 2020 11:46 AM
Reply to  p_davey

Thanks for the link – extremely interesting and thought-provoking analysis.

Cozmik
Cozmik
Oct 4, 2020 1:00 AM

You cannot use her Majesty’s troops on her Majesty’s subjects. I hope Boris knows this.

ginghiniagenie
ginghiniagenie
Oct 4, 2020 9:48 AM
Reply to  Cozmik

Where is this principle enshrined?

cozmik
cozmik
Oct 5, 2020 3:02 PM
Reply to  ginghiniagenie

It is under English law, illegal to use the Armed Forces to police Her Majesty’s subjects. When they are used to combat natural disasters that is a proper use of the Armed Forces to assist the civil authority during severe flooding or other disasters of a similar kind. However since the formation of a paid police force in 1829, the enforcement of law became the sole province of the police. Following the Bristol riots of 1831-2 III.State Trials, these trials confirmed the established law in the case of riot, felonious or tumultuous assembly and it confirmed the conditions under which soldiers can be used to support the civil authority – and the fact that when the Military are used to restore the rule of law, they do so not as soldiers but as ordinary subjects of the Crown with a clear duty to assist the Crown to restore the rule of law. 
 The armed forces can be used only in the event of a complete breakdown of the rule of law as occurs for example, in a riot. I would draw to your attention that during the Brixton, St Paul’s, Tottenham and the poll tax riots the civil authority did not consider it necessary to enlist the aid of the military. Our normal civilian police were able to cope and restore the rule of law.

Breaches of the covid regulations are a civil matter not a matter for the police, even allowing that the Government’s figures are correct and there is a considerable amount of conflicting evidence around the world from highly competent medical professionals which strongly disputes government figures and the action required.

Breaches of the covid regulations do not amount to a violent breakdown of law; the civilian authority is more than capable of dealing with any breaches which occur without the intervention of the Armed Forces.

The Prime Minister has announced what can be only a cabinet decision to deploy Her Majesty’s armed forces against Her Majesty’s subjects, whose only offence is to exercise their own minds and judgement and decide that they disagree with government policy. The intention to use the Armed Forces in this way constitutes a clear abuse of authority and the crime of misconduct in public office at common law.

Fact Checker
Fact Checker
Oct 4, 2020 9:36 PM
Reply to  Cozmik

Why? Because it would be a “crime”?
Hence the Covert Human Intelligence Sources (Criminal Conduct) Bill 2019-21
which authorizes and government agent to commit crimes, with impunity and without recourse.
(See Geoff’s comment above.)

Waldorf
Waldorf
Oct 5, 2020 11:38 AM
Reply to  Cozmik

Oh yes you can. In fact before the police force was established it happened constantly.

JudyJ
JudyJ
Oct 3, 2020 10:45 PM

Another experienced and honourable doctor suffers the consequences of opposing lockdown measures.

https://twitter.com/indepdubnrth/status/1312328750986649600

Simon
Simon
Oct 4, 2020 10:31 AM
Reply to  JudyJ

That’s how cults work. He should be glad to leave rather than worrying about upsetting other cult members.

Roberto
Roberto
Oct 3, 2020 4:26 PM

He, and his like are not ‘Tories’. They are not classic Liberals.
What are they? Crypt-collectivists? Is this neo-Maoism? Or just another historic mania? No need to update MacKay; just read the papers, or the history books since 1849.
The cure is usually some new distraction, but nothing else is working thus far.

richard
richard
Oct 3, 2020 3:52 PM

Brilliant Speech given by Martin Lee at Stand Up X Peaceful Protest meetup in Sheffield on 15/8/20.
He lays it all out really…

richard
richard
Oct 4, 2020 4:22 PM
Reply to  richard

Here’s another inspiring vid:

https://youtu.be/Vurv270Uv0I

Talk radio host Marc Dolan chops up his mask on air.

David Macilwain
David Macilwain
Oct 3, 2020 1:31 PM

Surely Tobias Ellwood is also part of the integrity Initiative? – but perhaps so is the 77th brigade.
As it happens, and it DOES happen – here in OZ we’ve just been watching “Arabia with Levison Wood”. In the last episode, Wood went into Syria, where he did his best to present the benevolent leader of Syria as someone who had forced or duped his citizens into submission – rather as Johnson and his ilk have done in the UK. Faced with the brave Hayat of Homs he struggled to keep it up, but finally made his escape over the hills into Lebanon’s Bekaa Valley. Following just a week after the Anonymous leak on the UK’s propaganda work in Syria, I was barely surprised to see that Levison Wood is with the 77th brigade, though surprised to see it admitted in the titles.
This is classic IfS media disinfo, like the recently screened “Salisbury Poisonings”, that so conveniently blended with the Navalny “poisoning”, on behalf of the Atlantic alliance.
https://ahtribune.com/world/europe/russia/4401-unexpected-poisoning.html

Jaguarpig
Jaguarpig
Oct 3, 2020 1:07 PM

This cunt deserves a big bat.

YeahBut
YeahBut
Oct 3, 2020 12:38 PM

The NHS has around 1250 hospitals. Not all of them will be suitable for COVID patients, but at the current daily death rate of 60, that’s an average of one death every 3 weeks per hospital.They’re overwhelmed, I tell you!

Simon
Simon
Oct 3, 2020 12:44 PM
Reply to  YeahBut

There is no such thing as a covid patient. Anyone defining someone as such is confessing membership and guilt in the covid terrorist atrocity which is a highly criminal activity.
https://www.loveproductions.org/english/articles/misinterpretation-of-virus/

YeahBut
YeahBut
Oct 3, 2020 4:15 PM
Reply to  Simon

Thank you, the reference you provided is to a self-published article by Stefan Lanka, a German molecular biologist who claims that viruses don’t exist as pathogens, that the objects described as viruses are misidentified components of the host’s cells, and that the process of establishing them as causes of disease is faulty. In particular he says that the process lacks controls, which if true is indeed surprising and concerning because controls are routinely used in diagnosis.

Unfortunately I don’t have time just now to do the necessary deep dive into the literature to confirm these bold claims. Sometimes such deep dives are well worth doing. Is this something you’ve done yourself here? It’s rarely a good idea to take any scientific paper at face value without at least following up the references; it’s not uncommon for references to say the opposite of what a referring article claims.

YeahBut
YeahBut
Oct 3, 2020 4:40 PM
Reply to  YeahBut

My own working view is that with COVID there’s more than enough shoddy mainstream science and shoddy reporting of mainstream science that can be debunked on their own terms, without the need to invoke alternative science (whether shoddy or otherwise).

Simon
Simon
Oct 4, 2020 10:53 AM
Reply to  YeahBut

The claims that sars-cov2 have met Kochs postulates are an excellent example of references saying the opposite of what a reffering article claims. Dr Kaufman describes how on digging into the references not a single one of the postulates was met and they used a different criteria than claimed. This is very common for the ‘vaccine cult’ which is why they very rarely post any links at all, almost exclusively relying on bullying techniques and various other disinfo tactics. https://www.bitchute.com/video/TXargSbVp7E/
https://www.bibliotecapleyades.net/sociopolitica/sociopol_mediacontrol36.htm

Jack
Jack
Oct 3, 2020 12:24 PM

When a politician advocates for medical martial law, sheeple cheer him on but when honest people warn them about the coming medical martial law, it’s just a ‘crackpot conspiracy theory’.

Simon
Simon
Oct 3, 2020 12:52 PM
Reply to  Jack

Mostly that’s just the ‘vaccine’ industy posting comments on the internet under various aliases.

Patrick Cosgrove
Patrick Cosgrove
Oct 3, 2020 11:38 AM

What on earth is wrong with using a resource that is trained in logistics and already paid for? Where’s the connection with martial law? There is none.

austrian peter
austrian peter
Oct 3, 2020 9:57 AM

Well spotted. I saw his speech and wrote to Ellwood. I got an immediate reply, noted in the thread below:

Dear Sir,
This is what I mean, and these are real facts!
https://in-this-together.com/the-new-world-order-and-the-european-union/
 
As you may not necessarily be in the club, even as a junior member, perhaps you need to know these facts. I have a computer full of information which is often labelled as conspiracy theories but which turn out to be true more often than not; and I write a weekly Letter to my American readers: https://www.theburningplatform.com/author/austrian-peter/ with the facts too.
 
Yours faithfully
Peter J Underwood
 
[NOTE
He replied in the negative. I am unable to disclose his reply due to restrictions with publicity on correspondence from MPs which is confidential as declared on all their emails. I will leave it to the imagination of readers.]
 
From: Peter Underwood <[email protected]>
Sent: 30 September 2020 11:56
To: ELLWOOD, Tobias <[email protected]>
Subject: You need to check you facts
Importance: High
 
Dear Mr Ellwood,
Before you propose implementing a police state here in UK enacted upon by the military, I suggest you check your facts and look at Sweden, Denmark and other countries. You should note also this advice from qualified people, unlike yourself.
https://off-guardian.org/2020/03/24/12-experts-questioning-the-coronavirus-panic
 
Nota Bene,
 
Yours faithfully
Peter J Underwood
A concerned patriot
UK Parliament Disclaimer: this e-mail is confidential to the intended recipient. If you have received it in error, please notify the sender and delete it from your system. Any unauthorised use, disclosure, or copying is not permitted. This e-mail has been checked for viruses, but no liability is accepted for any damage caused by any virus transmitted by this e-mail. This e-mail address is not secure, is not encrypted and should not be used for sensitive data.

Steve Hayes
Steve Hayes
Oct 3, 2020 3:59 PM
Reply to  austrian peter

If your MP or any other MP tells you something, you can tell anyone else what they told you.

austrian peter
austrian peter
Oct 3, 2020 9:37 PM
Reply to  Steve Hayes

I took notice of the email reference – but thank you anyway – I respect your good advice. I am conscience of copyright these days.

Tim Drayton
Tim Drayton
Oct 3, 2020 9:31 AM

Thought I would post this link in passing. It is to a cogent and informed article examining the flaws in the notorious Ferguson/Imperial College forecasts that were influential in pushing the UK and US in the direction of lockdown:

https://www.cato.org/blog/how-one-model-simulated-22-million-us-deaths-covid-19

YeahBut
YeahBut
Oct 3, 2020 12:09 PM
Reply to  Tim Drayton

The IHME (the go-to source in the US, also Gates-funded) has been almost as bad at assessing the non-lockdown case. They’ve repeatedly issued very high death forecasts for Sweden that have had to be scaled back as they met with reality. Currently they are forecasting a second wave with “only” 3000 deaths by the end of the year (scaled back from 17000 deaths in last month’s forecast!) if the Swedes don’t mask up. Sweden is averaging around 1 death per day.

MrChops
MrChops
Oct 3, 2020 7:54 AM

IT’S A KIND OF MAGIC……..

PCR test confirms anything you want……

Trump is in fact an Orange…..
The Quinn really is a Lizard………..

YeahBut
YeahBut
Oct 3, 2020 12:29 PM
Reply to  MrChops

In that video Dr Mullis is objecting to the amplification of a single copy of a target sequence, which is an argument against setting your detection thresholds much too low, not an argument against using PCR for diagnosis. It would be good to hear the actual technical arguments, if there are any, against use of PCR for diagnosis, particularly as we’re 27 years on from when that video was made. Without the technical arguments it’s an appeal to authority, which is really only going to persuade the already converted. On the face of it, PCR is quite well suited to quantitative measurement if used sensibly, particularly with modern streamlined equipment. Any diagnostic technique used badly will yield bad results.

Simon
Simon
Oct 3, 2020 12:59 PM
Reply to  YeahBut

First you would have to prove there was a pathogenic virus before any test could be developed for one. Since that hasn’t been done it is not a test but a tool used by terrorists to prolongue a terrorist attack with extremely criminal intent that needs to be stopped immediately.

richard
richard
Oct 3, 2020 3:16 PM
Reply to  YeahBut

Utter garbage! PCR makes as much “quantity” as you ask it to. Tell me, how does it identify a particular virus? Especially one which has not yet been isolated.

Researcher
Researcher
Oct 3, 2020 4:01 PM
Reply to  YeahBut

It’s out there. I’ve read them. Lift your finger and do your own research.

Mullis stated unequivocally that PCR cannot be used to determine the existence of a virus unless a UNIQUE genomic sequence from a virus is used exclusively in the PCR test. Since SARSCov2 has never been isolated or purified, its genomic sequence is fraudulent.

What Mullis uncovered with HIV was that it had never been isolated and purified either. Just like SARSCov2.

Moreover, Mullis expressly states that PCR can never be used to determine quantitative levels of a virus, therefore all those papers claiming viral load measurements are fraudulent. Every single published paper. No viral load test for SARSCov2 exists.

RT-PCR is not a diagnostic tool. It’s not used for diagnosis. It’s mostly used within industry for assays.

How convenient that Mullis is not alive to witness this massive global fraud.

Dylan Jones
Dylan Jones
Oct 3, 2020 7:09 PM
Reply to  YeahBut

“PCR is just a process that’s used to make a whole lot of something out of something. It doesn’t tell you that you are sick and it doesn’t tell you that the thing you ended up with really is going to hurt you or anything like that.”

The plain truth is that the interpretation of PCR, not to mention the false positive rate, is being abused when asymptomatic carriers of a fragment of RNA, which may even be a mere remnant of an infection that was seen off months before, can be used to manipulate a fearful public for nefarious reasons.

MrChops
MrChops
Oct 3, 2020 2:59 PM
Reply to  MrChops

Nice try with the logical fallacy argument…..

However PCR testing does not measure the quantity of what you have selected to find. Hence why PCR testing of COVID 19 can’t ascertain viral load or wether the RNA is live or not. Therefore a person with a positive PCR test can be perfectly well. I have met quite a few of them recently.

And yes Simon, I agree with you.

MrChops
MrChops
Oct 3, 2020 7:51 AM

BREAKING NEWS FROM CHANNEL 4 EXPOSES SCAMDEMIC
A news programme like no other…On seven nights a week and presented by Jon Snow since 1989, the programme reflects a commitment to:

  • Telling you what they don’t want you to know
  • Asking the questions you want answered
  • Being in touch with your lives & what matters to you
  • Exposing injustice
  • Holding to account

DunGroanin
DunGroanin
Oct 3, 2020 12:40 PM
Reply to  MrChops

It was set up as the ‘alternative’ platform to catch the audience that stopped tuning into the regular news propaganda programs on the bbc/ItV channels – there were only these 2.

The ITN people made Channel4 News and Snow is as much a grandee elite scion as any recruited into DS at University.

In recent years they have clearly steered the audience to the DS lies – especially the Syria Campaign / White Helmets lies – not a single retraction! They also followed the line on Anti Corbyn and AS.

All seen in a unguarded live election night transmission when the toaddy heir to Snow , Guru-Murthy, alerted Jess Phillips that she was live on TV with a massively pleased, champagne soaked gleeful face as the postal vote fixed poll results were announced, that would mean the threat of Corbynism would finally be removed!

“STRAIGHT FACE ,JESS!” He commanded.

————-

Fuck C4 fake Alt News, and fuck the fake Altsites that peddle DS integrity initiative tasked fake news.

Stewart
Stewart
Oct 3, 2020 4:45 PM
Reply to  DunGroanin

Channel 4 is an independent commercial TV station, right?

Er… no.

“Channel 4 is a publicly-owned and commercially-funded UK public service broadcaster, with a statutory remit to deliver high-quality, innovative, alternative content that challenges the status quo.”
https://www.channel4.com/corporate/about-4/who-we-are/what-is-channel-4

Publicly owned?

That means Government owned.

“Channel 4 is a public corporation of the Department for Media, Culture and Sport”
https://www.gov.uk/government/organisations/channel-4

Also, it’s managed by an outfit called UK Government Investments

“Acting as shareholder for, and leading the establishment of, UK government’s arm’s length bodies, UKGI manages a portfolio of businesses (including financial institutions managed by UKFI) in which the government has a shareholding, working with more than 10 different government departments and management teams to help these businesses optimise their performance to operate as commercially as possible.”
“UKGI is wholly owned by HM Treasury”
https://www.ukgi.org.uk/what-we-do/governance/

So it’s entirely owned and operated by the UK Government.

For any non-UK readers who might not have heard of Channel 4, here is an example of their “high-quality, innovative, alternative content that challenges the status quo”.

https://en.wikipedia.org/wiki/Channel_4#Wank_Week

John
John
Oct 3, 2020 7:24 AM

It is scary and needs to be stopped in its tracks.
Get rid of these politicians trying to take away freedoms.
The UK is perilously close to becoming a totalitarian socialist state run by Technocrats

austrian peter
austrian peter
Oct 3, 2020 10:03 AM
Reply to  John

As is the world, John. This short video from a doctor who has been exposing the Great Reset for many decades:
https://brandnewtube.com/watch/everything-that-has-happened-was-meant-to-happen_YzirTosrfBeJD65.html

S Cooper
S Cooper
Oct 3, 2020 12:34 PM
Reply to  John

“totalitarian socialist state”

Corporate fascism is not socialism.
comment image?auto=webp&s=7a3b398b3473cadd1338b2e2a580589a254a7fbd

John
John
Oct 3, 2020 2:26 PM
Reply to  S Cooper

Fascism is socialism, Its simply another branch of the same tree. Corporates can promote fascism as they do by being to compliant political policies of governments.

Researcher
Researcher
Oct 3, 2020 4:07 PM
Reply to  John

No. Other way around. Governments are compliant to corporations.

Capital controls. Always.

John
John
Oct 4, 2020 8:57 AM
Reply to  Researcher

Thanks for the opinion. Maybe I was not clear.

I would would put it that only a few mega corporations control Government. It is those same cabal of bankers and financiers the “Davos cabal” who actually control on behalf of the “Global Elite” the ones who believe they are the “chosen ones”, the ones behind the UN and IMF & WB.

The rest are simply compliant. That is most of the other corporations heads who are trying to become recognised as part of the “Global Elite”.
The accept the approved political policy of Governments as dictated to by the Davos cabal.

Objective to get favours in return from Government bureaucrats and politicians by compliance which ensures the right to pursue profit.

Maybe that is clearer.

Fact Checker
Fact Checker
Oct 4, 2020 9:57 PM
Reply to  Researcher

Gotta disagree with you there, ‘Searcher.

To use your excellent and evocative term, the cryptocracy works through both governments and corporations, to serve its anti-human ends. Neither is driving the other, because a deeper, darker force drives both to occult ends.

In fact “Capital,” as it’s understood, is a monstrous hoax, as it has come to comprise both fiat currency (only possible with governmental threat of force) and fractional reserve banking (only possible because it is enabled by governmental privilege given to banks, who should otherwise be held to account for conversion and fraud). So the specter of governmental force and authority is already inextricably embedded into Capital, so to say “Capital controls governments” is really just to say governments control through Capitol. It conjures fake money, that it then lavishes on its minions to curry their fealty.

Those devious Rothschilds were neither Capital nor Government.
They were a power and principle unto themselves, who effortlessly plucked both of those phenomena for their collection like wild daisies.

Researcher
Researcher
Oct 4, 2020 11:36 PM
Reply to  Fact Checker

Absolutely. It works both ways. But governments cannot have that level of control and leverage without capital.
And the Rothschilds and other money lenders go back several hundred years, all the way to the crusades and earlier. They are harnessing an evil force, of that, there is no doubt. But Rothschild and the rest of the banking cartel cryptocracy used capital and money printing as their leverage. With all the power and money the cryptocrats and their families possess, they’ve insulated themselves and built a grid around humanity and all our resources. The process starts at the top of the pyramid through the fractional reserve banking system and access to capital. Without control of the capital and the money spigot, managed through the untouchable BIS and sub structures such as the Fed, Central banks, the IMF and World Bank, they can’t achieve that level of power and control through governments, which are a newer structure that succeeded monarchies. Central banks own retail banks and are the largest shareholders of corporations. Now they’re transitioning to a new system based on digital money and cryptocurrency since the Ponzi scheme is about to collapse.

S Cooper
S Cooper
Oct 3, 2020 11:34 PM
Reply to  John

If that were honestly the case JD Rockefeller and the rest of the Robber Baron Corporate Fascist Oligarch Mobster Psychopaths would not have been persecuting, imprisoning and murdering those like Eugene Victor Debs.

“Some view the word EQUALITY as a direct threat to their criminal racket.”

John
John
Oct 4, 2020 9:11 AM
Reply to  S Cooper

Well anyone that believes in “equality” are deluded. That is the typical socialist Communist ideal of Utopia.
I agree fully that the “Robber Baron Corporate Fascist Oligarch Mobster Psychopath” are actually acting on behalf of “Global Elite or chosen ones” They are still socialists only looking after their families and their clipped circles and using the clericy to control the middle class, plebs or proletariats are the useful idiots.

S Cooper
S Cooper
Oct 4, 2020 2:01 PM
Reply to  John

In its instinctive drive for survival the ‘animal mind’ sees “more for me and less for others” as quite natural and fitting. In the words of one Raymond Kroc: “Business is war. It’s dog eat dog, rat eat rat. If my competitor were drowning, I’d walk over and I’d put a hose right in his mouth.”

Fortunately there have been and are others, such as Debs and allegedly Jesus, that see things differently. Concepts and ideas such as the brotherhood/sisterhood of humanity, mutual cooperation, equality, respect, dignity, justice and peace as our (humankind’s) future.

Given advances in technology, if humanity is to survive it will put aside the former and strive for the latter.

In peace and equality.

John
John
Oct 4, 2020 3:28 PM
Reply to  S Cooper

Who said business was a game. Survival is not a game. Life is not easy.

It is clear you in utopia. That is called dreaming. It does not exist unfortunately.

There is nothing wrong having respect for others, being moral, being and acting with integrity and honesty.

However mankind is only born equal, thereafter it is all about caring about survival and that of the family.

Equality can only be viewed in the sense that the playing fields need to be level and equality before the law.

Unfortunately there is always a problem of envy and desire of what others have either built up through their ingenuity and hard work.

Enter the socialist who is overcome by jealousy and envy of the success of the hard workers. The instinct is to resort to antiquated tribal rituals and then they resort to barbarian behaviour of pillage and plunder.

The liberal does not understand that the barbarians see any form of empathy or kindness as a sign of weakness and they exploit this always. They will continue until they have what they want and desire complete submission. The liberals are always shocked.

I always think of Desiderata and try to use that as a guide in life.

NobodyUKnow
NobodyUKnow
Oct 4, 2020 10:06 PM
Reply to  John

Many of the rich who are trying to rule the world and enslave everyone didn’t earn their wealth by hard work and ingenuity, they inherited it. These very same people are trying to steal the wealth of others who do work hard and make it difficult for them to gain more wealth and prosper, by impoverishing them and enslaving them.

The people I refer to never had to earn their wealth and so do not have any care, concern, or consideration for others.

While socialism can be rooted in envy, it is more often an attempt to equalize things and reduce suffering. After all, is it fair that some should suffer and live in poverty because they lack the capacity to earn a decent living, while those who had every advantage given to them can lie, cheat, steal and impoverish others in their efforts to amass more wealth than they know what do with?

S Cooper
S Cooper
Oct 5, 2020 12:29 AM
Reply to  NobodyUKnow

Socialism is based in the recognition that as human society develops technologically political economic democratic governance becomes even more essential for its survival.

A small clique of corrupt oligarchical psychopath master criminals “ruling the World” is a recipe for disaster.

John
John
Oct 5, 2020 6:45 AM
Reply to  NobodyUKnow

I partly agree with you, especially on the wealthy who have simply inherited and have done nothing to earn it. That is fact.
However to say that socialism is more often an attempt to equalize things and reduce suffering” couldn’t be further from the truth with respect. It is exactly what communists say. Same tree different stage of growth. Remember what one of the commandments say. “Thou shalt not covet thy neighbour’s house, thou shalt not covet thy neighbour’s wife, nor his manservant, nor his maidservant, nor his ox, nor his ass, nor any thing that is thy neighbour’s” 

Nothing in life is fair or equal. The difference between individuals will always exist.
So in desiderata we see “If you compare yourself with others, you may become vain or bitter, for always there will be greater and lesser persons than yourself.” There is always a place for compassion.

It is simple respect for others that needs to be given to all. “Do unto others as you would have them do unto you”. If one has the means to help others do so, but most use this as a demonstration of virtue. This is where it goes wrong , people expect something in return.

NobodyUKnow
NobodyUKnow
Oct 4, 2020 10:07 PM
Reply to  S Cooper

“More for me and less for others” is the creed of psychopaths.

Dr NG Maroudas
Dr NG Maroudas
Oct 3, 2020 6:08 AM

Bot alert! 5 IT robots have posted identical answers to a comment of mine. Their names and addresses are probably chosen at random from a program list, but just for the record: Job Bush, Censored68, Trillion Web, Yesset and Willis. The thrust of their post is to smear OffG as a “far right site” which peddles anti-Jewish conspiracies.

George Mc
George Mc
Oct 3, 2020 9:56 AM
Reply to  Dr NG Maroudas

Interesting. How much of the net is infested with these bots – not to mention troll armies? There will be whole training courses on how to defuse and disorient comment threads.

austrian peter
austrian peter
Oct 3, 2020 10:04 AM
Reply to  George Mc

It is likely to be the 77th Brigade to which Tobias Ellwood is associated.

Jura Calling
Jura Calling
Oct 3, 2020 5:32 AM

I’d say that a narrative requires no ‘management’ if it’s truth. It manages itself. To ‘manage’ a narrative is to manipulate it.To manipulate a narrative is to translate it into dishonesty and propaganda intended to conceal the truth of it.

Q 1 – In this short video clip, who identifies a need to manage the narrative ?

Q 2 – Are they connected in any way to the SAGE paper.

Q-3 Are they acting on the advice and recommendations of psychologists or virologists ?

These toffs in the Tory colours are letting their Freudian slips show. Bitches.

Footnote :

The second wave, and the amplified and exaggerated behavioural programming and threats of Government legislation being implemented ( as outlined on the SAGE paper as well as the 2010 Rockerfeller plan) all began via the mainstream Nazi machine on September 23rd.

24 hours earlier, Canada signed to accept 72 million vaccines from CIA venom-spitter, Gates, the head of poisonous pricks. Quite remarkable considering he and others have claimed there isn’t one yet.It’s as though there really is, but the lunatics have decided not to produce it until the twisted mind games have been played. But, as I said at the time, it’s all in the timing…

That other virus, ( pharma) a hybrid of greed, deceit and bullshit has spread quicker than all pandemics since September 22nd and Sept 23rd. And what happened on Sept 29th would explain how and why it had to. And why these cretins with the power are pretending that we’re all in bigger danger than ever before.That 72 million is already chicken feed.

It seems Bill and Melinda are in the throes of another financial orgasm. Their philanthropy has, once again, accidentally turned out to be a series of large investments that are set to yield even larger profits. What a shame. If only the world had actual leaders and not greedy, perverted psychopaths playing the role. And playing it painfully bad.

September 29th update ( Strategic Investment Fund my arse)

https://www.gavi.org/news/media-room/new-collaboration-makes-further-100-million-doses-covid-19-vaccine-available-low

austrian peter
austrian peter
Oct 3, 2020 10:09 AM
Reply to  Jura Calling

Well said. We need more people like you with their eyes open:
https://got-freedom.org/ in America and
https://www.keepbritainfree.com/so/feNGGLn3C?cid=7632c9c2-8c23-49b2-b61e-95f43d928871#/main in UK

Rick Giombetti
Rick Giombetti
Oct 3, 2020 4:46 AM

Heading towards medical martial law? Whether or not the UK and the rest of the Five Eyes countries are there, they all have leadership dedicated to implementing marshal law. With Trump’s announcement of a “positive” Covid test, I believe all the leaders of the FIve Eyes are now the only world leaders to have purportedly come down with the “deadly” virus and make a public spectacle of it. CDC comes out with that macro data demonstrating that Covid is the hoax the skeptics said it was from the start. So the Covid Coup partisans have to soldier on with the fear mongering narrative.

tonyopmoc
tonyopmoc
Oct 3, 2020 3:09 AM

Never assume you know more than your wife.

Whilst we get the occasional fox, hedgehog and frogs, I have never see a red squirrel in my life before and certainly not in our back garden, but I saw one tonight. Red Squirrels are extremely rare in the area we live, so I excitedly told my wife.

She says, I get up early every morning, whilst you are snoring. I watch the squirel from the kids bedroom, before they wake up. The squirel repeatedly goes to our local park, not far away, and brings back chestnuts and buries them in our back garden, and goes back for more.

She said the squirrel is not red.

I said well he looks red to me.

She said, what makes you think the squirrel is male?

comment image?crop=3078%2C1731%2C0%2C160

Tony

Jonn
Jonn
Oct 3, 2020 1:48 AM

The “scientific” paper “Investigation of a COVID-19 outbreak in Germany resulting from a single travel-associated primary case: a case series,” from “The Lancet Infectious Diseases,” is a complete fabrication.

The article claims to document a case where Covid-19 was spread from China to Europe.

The carrier of Covid-19 was Patient 0, a Chinese business woman who traveled from Shanghai to Munich on Jan 19, 2020, to facilitate workshops, and attend meetings with her German colleagues. She showed no signs of illness during her stay in Germany, although she mentions suffering from jet-lag. She returned to China on Jan 22 where she became ill, and on Jan 26 tested positive for Covid-19. It is claimed that, although asymptomatic at the time, she passed the disease to a number of German associates, who then passed it to others. Those who tested positive for Covid-19 (by qRT-PCR) had their virus sequenced. The sequences were submitted to GenBank. Those infected were called the Munich cluster.

One of those infected, Patient 1, is claimed to have caught the disease from Patient 0. Patient 1 then passed the disease to Patient 3. Since Patient 3’s only contact was with Patient 1, this certainly appears plausible, however, this turns out to have been impossible.

Consider the mutations (changes from the standard Wuhan sequence) of Patients 1 & 3.

Patient 1, MT270101.1, SARS-CoV-2/human/DEU/BavPat1-ChVir929/2020, complete genome.
ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGT1- (deletion at beginning)
C241T (substitution at position 241)
C3037T (substitution at 3037)
A23403G (substitution at 23403)
CCATGTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA29837- (deletion at end)

Patient 3, MT270103.1, SARS-CoV-2/human/DEU/BavPat3-ChVir1020/2020, complete genome.
ATTAAAGGTTTATACCTTCCCAGGTAACA1- (deletion at beginning)
C241T (substitution at 241)
C3037T (substitution at 3037)
A23403G (substitution at 23403)
TGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA29867- (deletion at end)

Given these, it is impossible that Patient 3 caught Covid-19 from Patient 1.

Relative to the standard Wuhan sequence, the virus from Patient 1 has lost (from its beginning) the segment
ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGT
However, the virus from Patient 3 has lost (from its beginning) only the shorter segment
ATTAAAGGTTTATACCTTCCCAGGTAACA

Also, the virus from Patient 1 has lost (from its end) the segment
CCATGTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
However, the virus from Patient 3 has lost (from its end) only the shorter segment
TGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

Therefore Patient 1 cannot have transmitted the virus to Patient 3, unless the virus from Patient 1 somehow found the missing segment AACCAACCAACTTTCGATCTCTTGT, and attached it to its beginning, and also found the missing segment CCATGTGATTTTAATAGCTTCTTAGGAGAA, and attached it to its end, with these attachments occurring sometime during the transmission. But this is clearly impossible.

For the same reason, the claimed transmissions from Patient 4 to Patient 5, and from Patient 5 to Patient 7, are impossible.

From: http://www.preearth.net/phpBB3/viewtopic.php?f=15&t=1184

WHAT DOES THIS SAY ABOUT ACADEMIA?

Dr NG Maroudas
Dr NG Maroudas
Oct 3, 2020 6:17 AM
Reply to  Jonn

Jonn, have you submitted your claim of scientific fraud to The Lancet? What was their reply?

John
John
Oct 3, 2020 7:41 AM
Reply to  Jonn

It’s all bullsh*t, numbers and sequences claimed to represent “something”.
That, ” something” can be anyone’s (Medically or scientifically qualified of course) guess as long as it has a number and a sequence.
Then it becomes the truth and fact.
Of course the original origin as yet unknown, unidentified or proven to exist,
It is all based on conjecture and assumption with an arbitrary cycle test that uses the sequences and adds or subtracts segments to attempt to prove its existence. Whoooo beware the spook of larga, “dark matter” voodoo science.
No, proven standard for comparison.

richard
richard
Oct 3, 2020 3:24 PM
Reply to  Jonn

garbage as usual – (your claims)

Jerry
Jerry
Oct 3, 2020 1:18 AM

‘Heading’ toward medical marshal law? LMAO

Gwyn
Gwyn
Oct 3, 2020 1:14 AM

Imagine what a sad little cunt a person would have to be in order to become a member of the 77th Brigade.

I mean, they’d have to be an unutterable WANKER. A soulless, gutless servant of illegitimate power.

A waste of a human life, basically.

George Mc
George Mc
Oct 3, 2020 9:58 AM
Reply to  Gwyn

There are plenty of them about. Let’s face it: they’re just a variation on journalist hacks.

austrian peter
austrian peter
Oct 3, 2020 10:21 AM
Reply to  George Mc

I understand about 1% of the human race are classified as such and the military deliberately seek them out – they also often become politicians.

austrian peter
austrian peter
Oct 3, 2020 10:19 AM
Reply to  Gwyn

As are all psychopaths. I met one once, that I know of – completely amoral and unable to relate to a person either emotionally or intellectually.

I practiced as a counsellor for many years and when clients become confused in their relationships with others I refer them to this excellent book by Dr M Scott Peck:
https://www.amazon.co.uk/People-Lie-Healing-Human-New-age-ebook/dp/B00UC6EF62

Rhys Jaggar
Rhys Jaggar
Oct 3, 2020 10:37 AM
Reply to  austrian peter

I find there are even more people who never went through emotional adolescence. By not going through that, they cannot relate to those whose value systems are different to theirs.

Emotional adolescence is a journey which leads you to understand what assumptions you have made about life and values and to examine what the consequences are of making different ones.

It is pretty key if you are going to be able to empathise with those who see the world very differently to you.

Tribal political parties almost demand such stunted emotional development as a badge of loyalty. Perish the thought that you could actually understand one of the ‘other lot’: you might find out you actually liked each other!

Gwyn
Gwyn
Oct 3, 2020 1:42 PM
Reply to  austrian peter

M. Scott Peck! I hadn’t heard that name in years. Thanks for the link.

DunGroanin
DunGroanin
Oct 3, 2020 1:03 PM
Reply to  Gwyn

They are a military organisation.

Any person who joins up the armed forces , for any reason except in a war to defend against a real planned invasion is a sociopathic morin or a inbred toff from a martial family that has traditionally been in the armed services ancestrally.

Only a generation or two ago many a poor area were used to recruit the mindless yes sir thugs that were the privates – the school teachers, would brutalise their charges daily with no intent to give any education/further education or change to outcomes for them telling the poor kids they were heading to Prison or Army and don’t even think of university!

The 77th has been operating this way across tge world far from our eyes – but have been deployed at home in recent years – completely against the ethos of not interfering in our civilian & political life.

As the elites, masters have deployed the DS and the military minions against their own citizens at the heart of their empire.

The DUMB soldiers believe that they are immune from charges of crime against civilians because they are FOLLOWING ORDERS!

They are as dumb as always – the Long, Short and the Tall – fuck em all. They will go on trial and they will never be allowed to wear their medals in public with pride.

Maarten "merethan"
Maarten "merethan"
Oct 3, 2020 7:58 PM
Reply to  Gwyn

Interesting way of waving back at the author of this article mate!

Gary Weglarz
Gary Weglarz
Oct 3, 2020 1:13 AM

The link below is to reporting on the “prestigious” New England Journal of Medicine – you know the same “prestigious journal” that along with The Lancet had to retract their peer reviewed but ever so “fraudulent” study demonizing Hydroxychloroquine, leading to it’s ban in the U.S. Now they’re on the bandwagon for mandated vaccines.

Amazing. One can only imagine the amount of money greasing the skids and buying this kind of completely ethically compromised “science.”

https://childrenshealthdefense.org/news/new-england-journal-of-medicine-mandate-covid-vaccines/?utm_source=salsa&eType=EmailBlastContent&eId=c4477440-fda3-4b3e-b993-fd97f29acaa0

Researcher
Researcher
Oct 3, 2020 5:50 PM
Reply to  Gary Weglarz

So you claim the virus exists. And you trust the published genomic sequence from Wuhan. And that HCQ is an effective treatment.

If it’s so safe and effective why aren’t the Chinese using HCQ?

Or the Russians?

Explain HCQ’s method of action.

Gary Weglarz
Gary Weglarz
Oct 3, 2020 8:42 PM
Reply to  Researcher

You might try trolling someone who doesn’t find your shtick laughable. Just a suggestion.

Researcher
Researcher
Oct 3, 2020 9:01 PM
Reply to  Gary Weglarz

Project much?

First you claim the West is the root of all this evil.

Then you claim HCQ is a magic cure to a virus that has never been proven to exist outside a BSL4 bioweapons lab.

You won’t answer the question about HCQ the wonder drug because it DIRECTLY CONTRADICTS your fake world view of Russia and China and the big bad West.

You’d have to admit that this is an agenda of globalization and that China, Iran and Russia are just as much a part of this Agenda 21,2030 as the 5eyes and the West.

Your claims defy logic.

You’re not smart enough to know when you’re incorrect and defeated, and not man enough to admit you’re wrong.

Gary Weglarz
Gary Weglarz
Oct 3, 2020 9:12 PM
Reply to  Researcher

“project much?” – wow troll-boy, you stole my favorite line to use with your ilk – “me thinks the troll-boy doth project too much!” What a low blow. I was so proud of that one too!

How about you do us all a favor and you go back to troll-boy central, have a nice talk with your troll-boy supervisor, do a little troll-boy brainstorming together and see if maybe you can get back to us with some new, maybe more creative troll-boy shtick – eh?

Your current shtick is so old and stale it appears to be leaving you a bit crispy around the edges – eh? You poor thing.

Researcher
Researcher
Oct 3, 2020 9:32 PM
Reply to  Gary Weglarz

Russia was using the Japanese flu drug, Avifavir, known generically as favipiravir, developed in the 1990s by a biotech now owned by Fujifilm. Russia formulated their own version they claimed targeted Covid19 more effectively.

“The drug works by short-circuiting the reproduction mechanism of certain RNA viruses such as influenza.“

No country used HCQ because it’s cardiotoxic and blocks the hERG channel.

The 2005 SARS-HCQ study that the NIH funded was clickbait left in the NIH database for dullards like you, to grab hold of and proclaim a cure has been found.

Hail Jesus! Hydroxychloroquine is a gift from God!

Gary Weglarz
Gary Weglarz
Oct 3, 2020 9:40 PM
Reply to  Researcher

(“No country used HCQ because it’s cardiotoxic and blocks the hERG channel.”) – so now you’re trolling the BS that had to be retracted as completely fraudulent by both the Lancet and the New England Journal of Medicine? Geeze, how transparent can you get?

That’s not what I meant by suggesting you get more “creative” with your troll-boy shtick – but hey – whatever.

Researcher
Researcher
Oct 3, 2020 11:28 PM
Reply to  Gary Weglarz

Quinoline structures are known hERG channel blockers. For decades. But don’t let facts get in the way.

2004
“Several antimalarial drugs are known to produce a QT interval prolongation via a blockade of the rapidly activating delayed rectifier K+ current (IKr), encoded by the human-ether-a-go-go-related gene (hERG).“

https://pubmed.ncbi.nlm.nih.gov/14729380/

2013
“anti-malarials were classified as high arrhythmogenic risk drugs (i.e. red traffic light)”

https://cordis.europa.eu/project/id/241679/reporting

Gary Weglarz
Gary Weglarz
Oct 3, 2020 11:52 PM
Reply to  Researcher

https://www.globalresearch.ca/cover-up-fauci-approved-chloroquine-hydroxychloroquine-15-years-ago-cure-coronaviruses/5713659

Geeze – turns out someone like you who doesn’t believe in this virus can still read about the efficacy of hydroxychloroquine in treating earlier corona viruses (see above link).

Hydroxychloroquine has been on the WHO’s list of “essential medicines” for many decades. As Lancet and the NEJM had to reluctantly acknowledge in retracting those “peer reviewed studies” – that it turns out that if you give chloroquine to people on death’s door and in literally what are considered lethal dosages – people for some reason “don’t get better” and might even die. WHO would have guessed – eh?

If you give a troll-boy enough rope they always end up hanging themselves. The pathetic irony of seeing your fawning support of the amoral Fauci’s fraudulent attack on Hydroxychloroquine was worth engaging with your nonsense – but just barely.

Jerry
Jerry
Oct 3, 2020 12:52 AM

Heading??? lmao

DunGroanin
DunGroanin
Oct 3, 2020 12:43 AM

Lol potus just played a double bluff on his Covid denier accusers!

Superb timing by his campaign peeps.

I bet his numbers go up this weekend and he wins any and every debate from now on.

Only a postal vote fraud can deny him the second term now.

tonyopmoc
tonyopmoc
Oct 3, 2020 1:40 AM
Reply to  DunGroanin

If he had the power, which I doubt, he would make postal voting illegal, as it is even more open to outright fraud than voting machines, as you Scottish should already know.

I know you Scottish voted to Leave. whilst I didn’t GFA either way, I watched the Count, and did a straw poll in my local pub. I went round everyone and asked them what they thought about The Scottish Referendum

Almost Everyone including The Scottish Told You Scottish To Fuck Off.

Have your own Independence…

See if we Care.

All My Family on My Mum’s Side are Scottish.

We are English now.

We seem to be very popular.

Everyone wants to move to England now.

Tony

tonyopmoc
tonyopmoc
Oct 3, 2020 1:50 AM
Reply to  tonyopmoc

My wife and I got married in Scotland and we are both English (Lancashire Dialect)

Steve Hayes
Steve Hayes
Oct 3, 2020 9:55 AM
Reply to  tonyopmoc

(Lancashire Dialect)

And yet you never write in Lancashire dialect, preferring instead to write in standard English dialect. Why is that?

DunGroanin
DunGroanin
Oct 3, 2020 1:10 PM
Reply to  tonyopmoc

“You Scottish”

Still you persist with your fake accusations.

You have trying to play the ‘English’ card for a while now as the Hard BrexShit will hurt the whole U.K. – the appeal to nationalism is your usual card.

You’re a one trick pony Compo , a very SCABY pony. You’ll never be anything else and your grave will have it written with big letters.

Grafter
Grafter
Oct 4, 2020 11:05 PM
Reply to  tonyopmoc

Stay off the whisky, your comments are tiresome .

Lost in a dark wood
Lost in a dark wood
Oct 3, 2020 7:54 AM
Reply to  DunGroanin

The Trump admin have been planning for it.

https://www.thegatewaypundit.com/2020/10/good-news-11th-circuit-court-overturns-democrat-attempts-steal-georgia-election-rules-ballots-must-postmarked-nov-3rd/
UPDATE: 11th Circuit Court Overturns Democrat Attempts to Steal Georgia – This is SIXTH LEGAL WIN for GOP and Election Integrity this Week
By Jim Hoft
Published October 2, 2020

John
John
Oct 3, 2020 12:16 AM

comment image

John
John
Oct 3, 2020 12:03 AM

BILL GATES ATTACKED OVER G4S CHILD PRISONERS ‘SHAME’

https://waronwant.org/media/bill-gates-attacked-over-g4s-child-prisoners-shame

Jura Calling
Jura Calling
Oct 2, 2020 11:50 PM

Did i see ”managing control” and ‘managing the narrative” there ?

These former public schoolboys are a virus in themselves. They’r basically doing as the head boy has told them to do. To say what they want to have said.

The armed forces have the ‘reach’ do they ?Great. This would be half of the mighty allies who spent 15 years as a task force looking for Osama Bin Laden in caves but didn’t knock on his front door until it was time to go home.

The same mighty allies who couldn’t find the evil weapons of mass destruction that threatened to destroy the west in 47 minutes. We’re 9 months into this virus and nobody has found it.Maybe it’s in a compound in Pakistan.It could be wearing an invisible bomb vest.Let’s hope once the heroic allies find it, shoot it, disarm it then bring it home to stand trial, they don’t drop it into the ocean and give the fish a cold.

But they have the tracking and tracing capabilities to follow us everywhere; to monitor our on or offline movements and thoughts. To dress up like futuristic Robocops armed to the teeth. Its the blind leading the stupid.

Johnson’s already been trying a new mantra out ” people aren’t paying attention”. I think that means we’ve stopped rolling over and running to fetch the sticks they throw.

Trump, who is threatening to become the White House’s first squatter in America’s history if Biden’s election fixers outsmart his own and has started to slip little anti-China quips in. he refers to the virus now as ”The Chinese disease”. I thought that was communism, oh Orange one.

It must be frustrating though. he’s the first president in god knows how many generations that hasn’t been able to invade another country and prompt the unofficial US anthem ( ”yoo ess ay! yoo ess ay!!”). Maybe blaming the virus on China will rescue his election campaign. Though rumour has it that Robert Gallo, Anthony Fauci, Bill Gates, Charles Lieber and all at the US Bio Weapons development centre have lost their voices..

This latest development( let’s call it phase two rather than second wave) is to test the effectiveness of their phase one, which was using the idea of a global threat to control the population through fear and having them offer their submission in exchange for a new normal. In evolutionary terms, this is a natural phenomenon.They say it’s about the ability to adapt to change. That’s why the sheeple will be the last to fall in the hole. They’ll adapt to anything whatsoever their handlers within the elite demand.They lack the intellect to ask a question. It’s us that face the kickback. Because we refuse to accept the martial law we all predicted 20 years ago.We all had it right.

2020 is the year that we realise hindsight never is. It never was and never will be.It’s bullshit.It just shows you the number of the bus that just hit you.Foresight is the acid test.And we had it and we called this,And they hate it.This martial law is further evidence of spite and anger.

Anthony Porter
Anthony Porter
Oct 3, 2020 4:03 AM
Reply to  Jura Calling

Trump, who is threatening to become the White House’s first squatter in America’s history if Biden’s election fixers outsmart his own and has started to slip little anti-China quips in. he refers to the virus now as ”The Chinese disease”. I thought that was communism, oh Orange one.”

Thank you. 🤣
So spot on and undeniably TRUE.
Just love your work Jura!
(This reply should earn me a few 👎)
😉

Jura Calling
Jura Calling
Oct 3, 2020 5:09 AM
Reply to  Anthony Porter

Thanks Anthony and don’t worry, a thumbs up here. Some may want more sugar with their medicine. And that’s not healthy anyway 😉

aspnaz
aspnaz
Oct 3, 2020 4:48 AM
Reply to  Jura Calling

Trump, who is threatening to become the White House’s first squatter in America’s history if Biden’s election fixers outsmart his own and has started to slip little anti-China quips in. he refers to the virus now as ”The Chinese disease”. I thought that was communism, oh Orange one.

Trump has been calling it that for a long, long time. You are out of date. Trump likes to be both factual and traditional when refering to the disease.

Jura Calling
Jura Calling
Oct 3, 2020 5:27 PM
Reply to  aspnaz

Trump blamed Wuhan, China at first. But, before his friends at Google and the various fake news outlets he employs could sweep the net and catch those calling him out, it transpired that Wuhan was in Harvard’s pocket, who employed Lieber, who was in Gates pocket.And then Fauci, who is in Pharma’s pocket.That’s Bill Gates, not Wong Tang Gates ; That’s Tony Fauci, not Ying Wang Fauci. That’s Charles Lieber, not Won Ling Lieber. So Trump learned to be a little more subtle, lest he be further exposed for the moron he is.

But the election looms and Trump, who’s only talent is to swagger like a John Wayne character, threaten wars to anyone who doesn’t marvel at him or declare Twitter wars from his bunker, is running out of ideas.

Here’s one Donny. Ask Fauci and Gates to explain why using a combination of HCQ and Zinc is being ignored in favour of treatment they have money invested in. Make the Scientists provide proof and back up their stats.Be a leader and not a celebrity imbecile.

aspnaz
aspnaz
Oct 4, 2020 12:08 AM
Reply to  Jura Calling

Trump still blames China. The virus came from China. The CCP have their “theories” about what happened, you have your theories, both about as believable as the test that proved that a paw paw could catch Covid.

So you hate Trump, we got that, but why hide it in bushes of nonsense.

Jura Calling
Jura Calling
Oct 4, 2020 6:22 PM
Reply to  aspnaz

The virus came from China. I see. It makes some sense. It’s war after all. And germs are the new explosives. Terrorism by stealth. America have obsessed about it for a century. But it doesn’t matter if you buy or blackmail your arms from another country. Once you use them, you’re to blame.Shall we talk about the FBI arresting Charles Lieber just before Xmas 2019 ? And his lies to them ?

There’s a ton of evidence pointing at the recent history of the US bio weapons ”research” and illegally dosing the military or selected groups full of diseases . It isn’t theory. It’s truth. Even the few Clinton apologised for are bad enough.

I don’t hate Trump. I find his personality as abhorrent as his politics. I find him a repugnant individual with the intellect of a house brick. I think he’d the worst thing Israel ever inflicted on America.And that’s quite a competition.

If you see bushes of nonsense or sense any hiding, you’re missing my trademark subtlety.

Voxi Pop
Voxi Pop
Oct 2, 2020 11:38 PM

https://worldchangebrief.webnode.comVACCINE TRIAL HORRORS: Intense Pain. Chills.Exhaustion.Fever.
Broken Tooth “Worth It”.500 Sharks 2b Killed/
500 German Docs Declare Pandemic Global Hoax Crime/ <—– read this!
NXIVM Sex Cult Heiress Jailed/ 
Hong Kong Protesters Rise Again/
600 Quakes Swarm Cali

Voxi Pop
Voxi Pop
Oct 2, 2020 11:39 PM
Reply to  Voxi Pop

500 Thousand Sharks – correction!

Voz 0db
Voz 0db
Oct 2, 2020 11:33 PM

Well… that scoundrel clearly does not regard himself as “key worker”!

Grafter
Grafter
Oct 2, 2020 11:21 PM

Oooh ! The Russians and the Chinese are coming to get us !! Let’s spend billions to keep you “safe”. Another scam fronted by an armchair military buffoon. We need to rid ourselves from these dangerous indoctrinated psychopaths who should be nowhere near government.

luke2236
luke2236
Oct 3, 2020 1:51 AM
Reply to  Grafter

Any clown that doesnt think the redchinese have designs on not only America, but western Europe also, should contact me about a swell rea lestate deal i have for them in Florida…
The red chinese have openly stated they have such intentions and have even shown maps of how they want to divide the US up. Russia is only slightly less forthcoming with their desire for Europe.
While it is true that there are ‘buffoons’ running the show and much of the money spent is wasted – no one in their right mind would argue that – to imply that those two groups pose no real and existential threat is foolish.

Grafter
Grafter
Oct 4, 2020 10:50 PM
Reply to  luke2236

Sleep now and stay away from MSM “news”.

John
John
Oct 2, 2020 11:16 PM

Dr John Lee talking sense with
@FatEmperor

https://twitter.com/zoeharcombe/status/1278770251497422851?s=20

JudyJ
JudyJ
Oct 3, 2020 5:04 PM
Reply to  John

Thanks for the link, John. I have just watched it. Excellent overview. I see it was recorded about three months ago but it is just as relevant today…even more so!

gorden
gorden
Oct 2, 2020 11:16 PM

the rmy are already in birmingham
g4s and serco are active
the problem is which of those 3 corporations are dressed up in police uniform

Jerry
Jerry
Oct 2, 2020 11:04 PM

Police Told NOT TO Use Track And Trace APP?

John
John
Oct 3, 2020 12:44 AM
Reply to  Jerry

They won’t have the vaccine either, or testing or self quarantining. They’ll be exempt from all that SAGE psycho torture stuff. That’s for us.

Buster Bloodvessel
Buster Bloodvessel
Oct 3, 2020 11:15 AM
Reply to  Jerry

Some pigs are more equal than others.

tonyopmoc
tonyopmoc
Oct 2, 2020 11:01 PM

I have come across a few weird things in my life, but never this before..

My wife just shouted to me come upstairs..

Come upstairs – See This. I can’t Turn it Off.

It is one of these old light bulbs you know the curly things, that have got mercury in them.

I fitted it about 5 years ago, and it has lasted a very long time for a light bulb, but I can’t turn it off either.

If if I turn it on it flashes very bright, and then goes dark very quicly – almost like a strobe…so I have being trying to kill it, but I turn it off and still shines light, but not as bright…

I reckon it will slowly die tonight, with the electric turned off.

If its stil on, in the morning, I will get the step ladders out, and remove it…

If it still lights up tomorrow outside in my hand, I will be really impressed.

This does not break any laws of physics. Phillips who deigned and built the bulb (subcontracted to The Chinese), probably gave it some capacitance too – like it retains some electricity when it is switched off..

My Son wouldn’t play such tricks on us, and we have no evil spirits in our house who can light up dead light bulbs so far as I know.

We are a House of Love. We often have young Children here.

“Madness – Our House (Official HD Remastered Video)”
https://www.youtube.com/watch?v=rXuvdeEC5y8

Tony

tonyopmoc
tonyopmoc
Oct 3, 2020 12:09 AM
Reply to  tonyopmoc

Fixed it. Got the step ladders out, climbed up the stairs,and pulled it out, and it was as dead as a dodo in my hand. Put a new low energy bulb in and everything is fine. I am still impressed how it ran with no electricity, but its in the bin now. I didn’t fall down the stairs, nor hardly make a sound.

There is no such thing as Free Energy. You have got to work to harness it.

Most of our Energy us humans use comes from below the Earth ( and most of it is not fossil fuel )

Most of the Energy that Grows our Food and Protects us From Viruses Comes from the Sun.

There is Enough Energy and Food for us all.

We live on the Best Planet in The Universe, so far as I know.

We are just suffering at the moment from these Malthusians who are trying to take control, and kill most of us humans off.

Some Indian Bloke recently said there is only about 150 of them trying to kill us all.

This is the long version. It’s probably all bollocks, but what do I know? As it comes from the Stanford School of Business (US) I wouldn’t take it too seriously, . The Yanks are currently in Self Destruct Mode and are Blowing Hot Air.

“Chamath Palihapitiya, Founder and CEO Social Capital, on Money as an Instrument of Change”
https://www.youtube.com/watch?v=PMotykw0SIk

Can any of them change a lightbulb?

Tony

Liv4ever
Liv4ever
Oct 3, 2020 12:36 AM
Reply to  tonyopmoc

his has been discussed in detail on yt channel Lookoutfa Charlie. With the advent of wifi and so forth, the air has become filled with signals. Certain frequencies cause fluorescent light bulbs to fluoresce.

Liv4ever
Liv4ever
Oct 3, 2020 12:50 AM
Reply to  tonyopmoc

Or simply your house is not wired properly

tonyopmoc
tonyopmoc
Oct 3, 2020 2:11 AM
Reply to  Liv4ever

The bloke who lived in our house before us was an Electrician. He worked incredibly hard on it – Rewired the Lot, and with his building mates, replaced the roof.

He put most of the crap – the building waste in a massive great pile in the back garden covered it with a bit of soil, and his wife grew a few plants in it – and said that is our Rockery. Isn’t it Pretty? My wife was not impressed with The Garden, but loved the house. It’s Big and Old – Loads of Space for Children and Friends

I could barely afford it, but bought it at the bottom of a property slump. Worked lots of overtime, and spent my spare time working in the garden, clearing the shit and taking it to the tip, whilst my wife with our own two young children, became a registered childminder..It took a year to get registered, and they checked me out too.

We wanted it to be a safe family home with a very long water slide – and we did.

We are going to do it again, cos we have Grandchildren now. They wil get bigger, and bring their friends round to Nana and Grandad’s house and have sleepovers etc, and may eventually have kids of their own

Such is life.

We want to be Great Grandparents now.

We Love Children, and my wife is Magnificent with them.

They all Love Her.

Tony

Liv4ever
Liv4ever
Oct 3, 2020 12:53 AM
Reply to  tonyopmoc

One more thing… dispose of properly…hazardous waste

tonyopmoc
tonyopmoc
Oct 3, 2020 12:49 AM
Reply to  tonyopmoc

They are our Grandchildren aged 4 and 2 You have got to be careful what you write in England after Midnight, when The Evening Shift – mostly from The USA turn up.

Leave us English alone You Grandmotherfckers.

We don’t like you except some of your Musicans who have moved to England cos The USA is such a sh1thole and they couldn’t stand it any more.

They are more than Welcome.

Most Americans under the age of 45 are now Braindead.

Some of you used to be Really Good. I worked with you.

Look at The State of You Now.

You are not doing very well.

Don’t blame us.

The USA is your Country. You make your own Decisions.

Got Nothing to Do with Us British.

Do you think Our Queen has any control over you Reprobates?

Tony

luke2236
luke2236
Oct 3, 2020 1:53 AM
Reply to  tonyopmoc

Its not just Americans under that age that are brain dead , its nearly all in the West. The English lead us tho by decades in their fall…just look at the relative mess and loss of liberty – the US cannot compare to Britain’.

Liv4ever
Liv4ever
Oct 3, 2020 9:05 AM
Reply to  tonyopmoc

You lost me there.. fluorescent bulbs contain mercury, which is hazardous waste

JudyJ
JudyJ
Oct 2, 2020 10:47 PM

Interview given by Dr Heiko Schoening to an independent German Internet TV station describing in English his recent arrest in London. His treatment was appalling and, by all accounts, his rights were completely disregarded. He confirms towards the end that he is in discussion with lawyers about suing the Met Police.

Michael G Eaglemeare
Michael G Eaglemeare
Oct 3, 2020 8:59 AM
Reply to  JudyJ

Meanwhile here in Germany, recently three school children have died whilst wearing masks. Dr. Bodo Schiffman who is a friend of Dr Heiko Schöning spoke with the parents of one of the diseased children and has no doubts through the conversation that the mask was the primary cause of death. Children need three times as much oxygen as an adult. How many more deaths of school children needs to take place before it hits international news?

JudyJ
JudyJ
Oct 3, 2020 10:35 AM

Thanks, Michael. Yes, I saw (and posted on here) Dr Schiffmann’s very emotional recent video in which he expresses his despair and frustration over the deaths of the three children. I don’t suppose you have any links to any German coverage of the deaths, no matter how inconclusive they might appear?

hope
hope
Oct 2, 2020 10:25 PM

Just to say thank you to all the commenters and to OffG. Ill have to stop commenting as I have too much work, nothing to do with covid, just much corrections and proofreading to do of things Id written long before covid, and that have been accepted for publication, nothing to do with today, just long past history…

JudyJ
JudyJ
Oct 2, 2020 10:44 PM
Reply to  hope

hope

It will probably do you good to focus on something non-Covid related! I look forward to welcoming you back when your time is freed up again. Hopefully (but I am not yet optimistic) we will all be in a ‘better place’ then. All the best.

Todd Hayen
Todd Hayen
Oct 2, 2020 10:19 PM

Just saw a meme today on Facebook posted by a good friend “Study shows that 100,000 lives would be saved if 95% of Americans wore masks for one year.” His comment, “come on guys, wear those masks!!” Where does this dribble come from? And why do people believe THIS but don’t believe all the very sound scientific data that says the opposite? He ended his post with “there’s a reason why surgeons wear masks when they operate!” I didn’t have the heart to explain to him that mask wearing in surgery is to prevent bacterial infection…they don’t do diddly squat for viruses. Why doesn’t he believe that? Yet he is the first to proclaim “follow the science!!”

Sorry…I know you all hear this day in and day out, yet I am still not past my absolute amazement that people are so sucked into all this. I see myself giving up…and just not bothering to respond to this sort of crap…and “hiding” the post so I don’t have to see it. Of course FB should die with the rest of this nonsense.

Venting. Thank god there are a few sane people out there…thank you OG, your authors, and readers. Hopefully we will be able to “meet” somewhere after the meltdown. I have suggested that we all learn morse code…the internet will be gone, and voice communication over airwaves will be seriously blocked. Morse code transmission can get through anything…and more difficult to find and confiscate the hardware…

Arsebiscuits
Arsebiscuits
Oct 2, 2020 10:23 PM
Reply to  Todd Hayen

Hope you told him he’s spreading dangerous misinformation

John
John
Oct 2, 2020 10:41 PM
Reply to  Todd Hayen

There needs to be a serious challenge to the nightmare joke that is PCR Tests. Just heard 770 students FALSELY IMPRISONED in Newcastle upon Tyne

PCR Tests are a global scandal. Might as well toss a coin

How do these ‘testers’ sleep at night?

Feel so sorry for young people who are being unfairly punished (by who?) for no good reason

Bill
Bill
Oct 3, 2020 12:38 AM
Reply to  John

Well one of the companies making PCR tests are being sued. Small step for mankind. Lawyers and judges are now coming on board, That to will grow. Step by Step. https://shadowsbearsoutlook.blogspot.com/2020/09/pcr-covic-19-tests-are-worthless.html

John
John
Oct 3, 2020 3:50 PM
Reply to  Bill

This is the best hope at the moment. Everything needs to made of this issue. It must be exploited ruthlessly by multiple class action groups, not just one.

Our lives are being destroyed because of these fraudulent ‘tests’.

I despise the scientists/testers etc who know the tests are not fit for purpose but who are still using them anyway. They’re helping to turn the future into a dystopia our children will have to live in.

Bill
Bill
Oct 5, 2020 10:21 PM
Reply to  John

This is the man speaking in English, Reiner Fuellmich goes into a lot of detail. Definitely worth listening to. They are also willing to share all of the information/evidence they have as well, with others, who want bring a legal challenge to their countries etc. https://rainbowwarrior2005.wordpress.com/2020/10/04/legal-action-against-covid-pcr-tests-crimes-against-humanity/

richard
richard
Oct 3, 2020 3:40 PM
Reply to  John

The PCR tests are being knowingly misused…
Really, it is just a manufacturing technique – not a test as such.

Bill
Bill
Oct 3, 2020 12:32 AM
Reply to  Todd Hayen

Never give up Todd. Just take a break and do something nice for yourself. Have a bit of fun. Then look at all the kids wearing masks knowing their teeth will rot due to mask wearing and that will revitalize you. That is how I do things. I have some fun. Be nice to me time, to rest and distract me, from the garbage, then find something that pisses me right off and oddly enough that gives me energy like a roaring steam engine to go on. I even mannage to have some fun with the trolls that go around annoying people. The UN send out some to a while back. They are great toys to play with, if you know how and I have twenty years of practice with them. Fun times. So they are sending out the UK military guys, that should be interesting. The UN ones are failing big time. They will do everything to dicourage you or anyone from telling the truth. They can be rather nasty. So when you run into one like that. Giggle. If they go after you that means you are doing it right. I have been called every name in the book and I am bloody proud of everyone of those nasty names. Snicker. That just means I am doing it right. So if you ever meet one just laugh at them. They amuse me.
Anyway take a few days of coffee break time to revitalize. Remember there are millions of us now, so taking off for a day or two is ok. Soon those millions will be billions. We are spreading like wild fire now. Yay, Cheers to all of use who have been working on this.

Here is some information on the harm that masks can do. Dentists are starting to come out too.Masks can rot your teeth. That can also lead to other health problems too. https://shadowsbearsoutlook.blogspot.com/2020/09/masks-are-just-not-good-thing.html

Here listen to this. Now just inagine that is say Bill gates sitting with his billion and everyone else are the folks, who don’t like him for soooooooooooooo many reasons. Mr Vaccine. He has destroyed a lot of innocent lives. Now imagine all those people want him fed to the lions. We had that crowd before we even started all of this. Only there are many more millions, then you see there. So use your imagination and giggle. You can put any one in that chair you want to. I hope that brightens up your day. https://www.youtube.com/watch?v=W7jkygJ_QNo

Bobby Joe
Bobby Joe
Oct 3, 2020 12:53 AM
Reply to  Todd Hayen

The masses are simply assuming the role they have always been taught to assume. It has been this way throughout history only we live to believe the world we live in is magically different to the world lived in previously by others. This is a myth. Humanity has always gravitated towards submission and subservience. The masses have always been obedient under most circumstances. We base our societies on social hiearchies which depict this very truth. Why are the masses not aware of how many things happen in their world? It’s obvious. Their role doesn’t accomodate such luxuries.
This should reflect why you see people blindly sharing bullshit on social media, and why they even implicitly trust social media in the first place. It is their role as followers, as sheeple (hence why we call them that) to blindly walk through life having never bestowed upon themselves the responsibility to understand anything more than a very small existence, to never question things and take it upon themselves to learn. And I mean a very small existence as if in the potential for individual development and transformation, not material wealth or academic success or social status.

Nothing new. You’re just seeing the true reality of what role most people play in their life. You might think you know people, and in many cases you may actually know people who seperate from this years events are seemingly self aware and conscious and integrated but the reality is many people are assuming a role that when given stimulation to trigger coming into full view you discover they were part of the herd all along.

This is how it works. Don’t be angry. It wasn’t long ago much of the world believed in supernatural forces capable of ruling over our lives if we did not do certain things right to fight off sin and impurity. When we say “much of the world” who are we referring to? That’s obvious. We are referring again to the herd, the flock, the sheeple. The very same people who today fear the heavens under the guise of the coronavirus.This is simply the next narrative the masses follow and in the process assume the respective role.

Jeffrey Strahl
Jeffrey Strahl
Oct 3, 2020 1:26 AM
Reply to  Todd Hayen

Many people are have fallen in love with fear.

JoeC
JoeC
Oct 3, 2020 3:31 AM
Reply to  Jeffrey Strahl

So much so that they have embraced it.

JudyJ
JudyJ
Oct 2, 2020 10:01 PM

Anti-lockdown podcast by retired Scottish doctor, Dr Colin Barron, who is a ‘disciple’ of Vernon Coleman.

https://brandnewtube.com/watch/why-i-support-anti-lockdown-protests-by-dr-colin-m_xdTPFsRSML5yiGk.html

Lost in a dark wood
Lost in a dark wood
Oct 3, 2020 8:43 AM
Reply to  JudyJ

Dr Colin Barron also has a youtube channel where the video has been uploaded. I tried posting the link, but it’s currently working its way through the approvals pipeline.

Lost in a dark wood
Lost in a dark wood
Oct 4, 2020 1:49 AM
Reply to  JudyJ

I’ll try again!

Why I Support Anti-Lockdown Protests by Dr Colin M. Barron
Sep 25, 2020
Colin Barron
Former NHS Medical Doctor, Dr Colin M. Barron explains his concerns about the way Governments are handling the coronavirus pandemic

Lost in a dark wood
Lost in a dark wood
Oct 2, 2020 9:57 PM

Re: “Managing the narrative.”

It’s time to ask: Who’s afraid of postmodernism?

Libertarian Postmodernism: A Reply to Jordan Peterson and the Intellectual Dark Web
Sep 26, 2018
ReasonTV
Reason’s Nick Gillespie defends Foucault, Hayek, and an “incredulity towards metanarratives.”
Full Transcript Available Here:
https://reason.com/video/libertarian-postmodernism-a-reply-to-jor/

People of many political persuasions have identified postmodernism as a major threat to civilization. The most notable recent attacks have come from Jordan Peterson and other members of the so-called “Intellectual Dark Web.”
Reason Editor-at-Large Nick Gillespie has a problem with that. He sat down with Zach Weissmueller, video journalist for Reason TV, to discuss and defend postmodernism — a term he says has been widely mischaracterized by its most vociferous critics — from a libertarian perspective.

Produced by Zach Weissmueller. Camera by Lorenz Lo.

ttshasta
ttshasta
Oct 3, 2020 12:45 AM

IDW, intellectual dark web is great.
I love seeing intelligent opposition to whatever Woke means and identity politics.
IDW Eric Weinstein, brilliant guy, thinks identity politics are the cheapest platform for Democrats; cheaper than catering to workers with healthcare or rent control, etc. IDW Jordan Peterson notes that today’s college students have the most open, fair and equitable campuses ever imaginable by enlightenment thinkers.
IDW Ben Shapiro notes that facts don’t care about your feelings. Jordan Hall, formerly Greenhall, has great insight into US 2016 election in The Glitch In The Matrix video.
I may not like Shapiro or Peterson so much now, but IDW’s boots on the ground thinking is more needed than TED Talks IMHO.

Lost in a dark wood
Lost in a dark wood
Oct 3, 2020 1:22 AM
Reply to  ttshasta

Do they say anything about “incredulity towards metanarratives” ?

See:
https://en.wikipedia.org/wiki/Metanarrative

Lost in a dark wood
Lost in a dark wood
Oct 3, 2020 1:28 PM

Is this what passes for libertarian intellectualism?

Whereas I think Jordan Peterson and the IDW seriously misrepresent postmodernism, and that Nick Gillespie of Reason Magazine does a partially acceptable job of pointing this out, there seems to be very little “incredulity towards metanarratives” at Reason itself. For instance:

https://reason.com/podcast/are-pandemic-pods-racist-a-soho-forum-debate/
Could All Parents Have ‘Pandemic Pods’ If There Were More School Choice? A Soho Forum Debate
As K–12 education goes remote, groups of parents are hiring teachers to teach their kids in person. Is that wrong?
Nick Gillespie – 9.18.2020
Arguing for more government spending was Jon Hale, a professor of education at the University of Illinois, Urbana-Champaign. Arguing in favor of pods and other parental innovations was Corey DeAngelis, director of school choice at the Reason Foundation, the nonprofit that publishes this website. Soho Forum Director Gene Epstein moderated the debate.

How about arguing for the position that it’s all a humongous scam?

dr death
dr death
Oct 5, 2020 7:16 PM

snake oil salesmen peddling pabulum, brain rot, a fifth column.
watch peterson squirm, when asked on his views toward his great hero solzhenitsyn’s opus 200 years together.
he should go home take his meds and clean his room.

Lost in a dark wood
Lost in a dark wood
Oct 6, 2020 2:32 AM

With regard to the question “what is postmodernist philosophy?” I’m still very much at the stage of gathering a variety of opinions. However, the following seems to be a reasonable place to start.

Themes of Postmodern Philosophy
Jan 21, 2018
Philosophy Overdose
Professor James Anderson gives a very broad overview of some of the themes of postmodern philosophy. This is from a course on the history of philosophy.

Lost in a dark wood
Lost in a dark wood
Oct 8, 2020 1:02 PM

I’ve copied the following from different thread; and it summarises my working theory regarding the systematic misrepresentation and demonisation of postmodernism.

Re: postmodernism was strangling the life out of truth, reason, and evidence-based scholarship.

My knowledge and thinking in this area is still very much in development, but I’m leaning toward the view that “truth, reason, and evidence-based scholarship” is the essential characteristic of the original meaning of postmodern philosophy. Hence, postmodernism was a serious threat to the technocracy (e.g. it had already killed off Freudianism) and so it became the primary target. The technocracy defeated (subdued) postmodernism by distorting it into absolute relativism and identity politics.